late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2) - 247 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.4402
gtgtgtatgtgcccatccctccatagccctgggcccagccttcgtgcttctacactgtgt  c.321+60

         .         .         .         .         .         .  g.4462
tcactcccaccaggaccctgtttctagagttctcatgtctactcagtccatttctggtgt  c.321+120

      g.4466
gggc  c.321+124

--------------------- middle of intron ---------------------
                                              g.4467          g.4469
                                              c.322-123  cag  c.322-121

.         .         .         .         .         .           g.4529
ctcccaagagcaggtgggggttgggggctggttgcttcctatggcactgggagcagacct  c.322-61

.         .         .         .         .         .           g.4589
ggatttggggtccctaatgccaggctgtgtgcgggactgatctctgttctccctctgcag  c.322-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center