ligase IV, DNA, ATP-dependent (LIG4) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the LIG4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000013.10, covering LIG4 transcript NM_002312.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.8101
                                                        ctggc       c.-241

 .         .         .         .         .         .                g.8161
 ctcgggcaagctccgttacctctgtgaaccagagaatcccagctgtaaaatgagatcttg       c.-181

 .         .         .         .         .         .                g.8221
 atggtttcctgcggggttgccatgagaaagaatcaacatgtacgcaggtaaagcaggcaa       c.-121

 .         .         .         .         .         .                g.8281
 tacagttccagggagtcaaaaacgggagaaatcgtcccacgacctggggcttgggtctag       c.-61

 .         .         .         .         .         .                g.8341
 atgaagagcacagcatcaggaggccaggcttctaatgcggcgcagtctacagcgctgtgg       c.-1

  | 02       .         .         .         .         .         .                                                               g.8401
  | T                                                               c.1
  | ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?      p.0

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ligase IV, DNA, ATP-dependent protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.