lipin 2 (LPIN2) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the LPIN2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000018.9, covering LPIN2 transcript NM_014646.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 GATGACTTGTTTCCTTTGGTTCTTTCTTGTATTAATTCACCCTTGGGGTTCACGGTGAAT       c.60
 D  D  L  F  P  L  V  L  S  C  I  N  S  P  L  G  F  T  V  N         p.20

          .         .         .                                 g.93
 ATTCTACAGTCTGGAACTCCAACTTGTGTGTAG |                               c.94
 I  L  Q  S  G  T  P  T  C  V  X                                 p.30

          .  | 02      .         .         .         .         .    g.804
 gcatagacatc | atttggacggtttccaaaggcagcatagaagggctgcttagacggggca    c.*60

          .         .         .         .         .         .       g.864
 aacagattcttgatatcatttagacactcaattttgaacttctctggtttcttttctatc       c.*120

        | 03 .         .         .         .         .         .    g.1323
 acttct | ctgtggaaggcggagaacaagctgctgggggacagcatcagggggccccggggc    c.*180

          .         .         .         .         .         .       g.1383
 aagattgtgcccttgtcattgacccagtgcaggtagccacgggtcatgtcggccatgccg       c.*240

          .         .         .          | 04        .         .    g.3018
 atggcacgagccgagcagtacagaaacttgtagccattc | tcattgatggaatggtagagc    c.*300

          .         .         .         .         .         .       g.3078
 tttgctataccctggtgggtccagtctttgcccagctgtgggagaatctgtcccaaagca       c.*360

        | 05 .         .         .         .         .         .    g.3674
 tccgac | ttggttattgtcccatcaatatcagaaatgatgatcttgtcattccagttccac    c.*420

          .         .         .         .         .         .       g.3734
 aggtaaatggtccctgcacagcgacaggtgccttgatactgggttgtaatactaaacaca       c.*480

          .         .         .      | 06  .         .         .    g.4471
 acatcatttgggccatcgtggagcttcagttttgc | gatctggtctgaggagaggcggaga    c.*540

          .         .         .         .         .         .       g.4531
 gacttcttatatgaagttgtgctgccgtggctcaggggctctgtggggatggggtccact       c.*600

          .         .         .         .         .         .       g.4591
 gtgatggattcttcgagctcctgtgatccctcgtcactcgaggagtcattctcggccggc       c.*660

  | 07       .         .         .         .         .         .    g.6005
  | ctggcaccggccggctccttggagctggatggcaggtcactggctggcggtgcctcagat    c.*720

          .         .    | 08    .         .         .         .    g.6981
 tttccctccttggattctggcag | ctgtttggtcatgctttctctctttcgccaaaaccac    c.*780

          .         .         .         .         .    | 09    .    g.7820
 cagcgaccagatttctttggcatcttgtctttcacccaggactcaactgtggc | cttaggc    c.*840

          .         .         .         .         .         .       g.7880
 aagctcttctggaatacttgcaagctaaggatcatgggagctgccaaagcccagttatag       c.*900

     | 10    .         .         .         .         .         .    g.8344
 taa | cgattatatatccttattacaaggttaggattgtctataagtccagggttttctgca    c.*960

          .         .         .        | 11.         .         .    g.10501
 aattcgtgataagtaatgatatgctccatgaattttt | cttttgaaatttctccattttca    c.*1020

          .         .         .         .         .         .       g.10561
 ctgaggcccccgcaaagggagagggtaacgtcaggcaagtccatggcagaatctgagagg       c.*1080

          .         .         .         .         .         .       g.10621
 cactcggtgccgctatctgcagctgcgcttcccacggactgtggggactgggagccagag       c.*1140

          .         .         .         .      | 12  .         .    g.13588
 agtgtgtcagactcgggccactgcctggaaccgggctccgattca | cttttagggaaataa    c.*1200

          .         .         .         .         .         .       g.13648
 agagctgcaacttcaggttctagaccctttaagtcatcaaggtaaatatcatcaggtccc       c.*1260

          .         .      | 13  .         .         .         .    g.16949
 tggtgttggcttcttttgtgaacac | ctttcttctttgacggcgagtctactttagctgcc    c.*1320

          .         .         .         .         .         .       g.17009
 ggtttggattctgagggcgcctccgctaaggctgcgttgggaaggtggtcagcatctaac       c.*1380

          .         .         .         .         .         .       g.17069
 atagatgaaatctgagtactctcaagaggaggttcgagaagctctgccacagatgttggg       c.*1440

          .         .         .         .         .         .       g.17129
 tcgctcatctgtgtacccagggctctgggtttgggcttcactatggtacagacagtgtct       c.*1500

          .         .         .         .         .         .       g.17189
 tccatggaagcatccttctcaacttcactgatgaggttgtcctcactgggaattacccga       c.*1560

          .         .         .         .         .         .       g.17249
 aaatgagtattttctgatggtgtaattgtagctgtcctaggatgatggtcagatcgttct       c.*1620

          .  | 14      .         .         .         .         .    g.18751
 cttttgctgac | cttggtggactctgggaatccgccccacgtccactccatgtgagactct    c.*1680

          .         .         .         .         .         .       g.18811
 gatctgagcaggctctccgcaggtttcacctccagctctgaatcactcttaggacacgct       c.*1740

          .      | 15  .         .         .         .         .    g.19872
 gtctggggataggtg | gtctctaaaggggaccaatctccatcagataaggggtaatgatcc    c.*1800

          .         .         .         .         .         .       g.19932
 ccagaatggaagagcaaaggctctttacattcttcttctttcaaggaagcatttgaagat       c.*1860

     | 16    .         .         .         .         .         .    g.30334
 cct | cgtgctgcctgggcccccttgtcatcatcggagctcacgcctacatcacatgtgtct    c.*1920

          .         .         .         .         .         .       g.30394
 tctgcagcagcagatgcggcctgctcttccttcttactgtcctgtttgtatttctttctc       c.*1980

          .         .         .         .         .         .       g.30454
 cttcgttttttctttttcacagaacttggagtaaaaattgtctctgtttccaagacgtgt       c.*2040

          .         .         .         .         .         .       g.30514
 gagatgtctgaactctgagatggtgtttcatctccacccgatttcaccaaaggggtgtca       c.*2100

          .         .         .         .         .         .       g.30574
 atatctttaaagaactgatcttcagtaggaattggtgaggtggcaaggtaagcaggaagc       c.*2160

       | 17  .         .         .         .         .         .    g.33781
 ttttc | atattcttcttcagtctcctcaacaaagaaagcttctccgttatcacccaacttc    c.*2220

          .         .         .         .  | 18      .         .    g.39890
 atgtgaagatccactgcactgccgttgatttctatatcaat | cactttctctttggatctc    c.*2280

          .         .         .         .         .         .       g.39950
 aggactcccagctttccaaaccgaacgtgaaaaggtgaacactgatagctgccatcctgc       c.*2340

          .         .         .         .         .         .       g.40010
 tgctgtaccacgatgacatcaatgcacccagagagggtggcctggttaatgcccttgtag       c.*2400

          .         .         .         .         .         .       g.40070
 agttccttcacagtgacaatcacctgcccagccagctgtcccacataattcatggtttga       c.*2460

    | 19     .         .         .         .         .         .    g.90998
 ga | cacaatcaactacaatgtaattggagggaagagccgatgttggacggctatcacacgt    c.*2520

          .         .         .         .         .         .       g.91058
 ggcttcacactgttctttttcttctctggctgggtacggcctgaggatgactgccctcca       c.*2580

          .         .         .         .         .         .       g.91118
 acaactgaggatgctgcaggaggaccagcccagcacctgtctccatcccctgcactgtgt       c.*2640

          .         .         .         .         .   | 20     .           g.91178
 ggccggctctgccgcttctcccccgcttcagcatcacctgccacttcttctc | c           c.*2693

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Lipin 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.