magnesium transporter 1 (MAGT1) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the MAGT1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering MAGT1 transcript NM_032121.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .                                                         g.12
 CTGTATGGGTAG                                                       c.12
 L  Y  G  X                                                         p.3

          .         .         .         .         .         .       g.72
 ccatgatatttagatctaaaaatagagagcatccaactgaagaataatacaacaagtcca       c.*60

          .          | 02        .         .         .         .    g.10482
 ataccagccacacacatta | tctttcgctttccaatatccatgtcagaggtagcagcttca    c.*120

          .         .         .     | 03   .         .         .    g.23122
 cataaaagcaccattcctaaggtaactccaccat | taaacagaagaacaatgtgtgtttca    c.*180

          .         .         .         | 04         .         .    g.24718
 gctacaaactgggcttgactgcttccatggatataatt | cacatgtcccgtgtggggattc    c.*240

          .         .         .         .         .         .       g.24778
 ttatgggcatatggtggtcctcttatatggttccacatttgaccagatgtcatagcaagc       c.*300

          | 05         .         .         .         .         .    g.25980
 acaaaaca | caaagctgcaaaagcccatccagttttattaaagagaaattccatattactt    c.*360

          .         .         .         .         .         .       g.26040
 cttcgaagatacacaagtccaccaataacagccaaaagcaatcccaacataaggggacca       c.*420

          .         .          | 06        .         .         .    g.26583
 gcataatttgggggtctaatcactctaat | attgacatcagttctgtcggcgatccaccgg    c.*480

          .         .         .         .         .         .       g.26643
 gcaatctgctcagctgaaaaaccccgcacctgtaactcatatgtatcaccccgtttgggt       c.*540

          .         .         .         .         . | 07       .    g.40013
 ttcccttttgcaggaaagttgatgaaagttggagctgaattcatgtttag | catctgaaat    c.*600

          .         .         .         .         .         .       g.40073
 acatcagagccttcatcaaaatccaccatggcaaaaaatatcctgttggtgaatgcactg       c.*660

          .         .         .         .         | 08         .    g.44635
 gagtatcgccaggagtttgccaggatctggaattcttcatcagcttgc | ttgcaaacgaca    c.*720

          .         .         .         .         .         .       g.44695
 cactgtctatgcagttggagagcagtgaacatgacgataacggagtaatttctcggtggg       c.*780

          .         .         .         .         .         .       g.44755
 gctttcacaaggcgacggaacttgtctccattcattcttattacaggtcttttgttagtc       c.*840

          .         .         .         | 09         .         .    g.64526
 cattccatcagctgactaaccttttcagataacaccat | ctccttctttctttgggcagag    c.*900

          .         .         .         .         .         .       g.64586
 gctgagggaacgtcgcaaacgatgagcagcgccaccaccatggtcacagagacacaccaa       c.*960

          .         .         .         .         .         .       g.64646
 aaccgccaacgcgctgccatgttcgctcctctcccttctataagtgaaactttgctccgg       c.*1020

          .         .         .         .         .         .       g.64706
 ctaggtctgagggtggggcgtgagaacaggcaaatcggccccttgcctttcctcattggt       c.*1080

          .         .         .         .         .         | 10     g.64766
 ccagctcagccctgccgggagacccctcacattacgtcacagcgcgctggcgctacac | g     c.*1139

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Magnesium transporter 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.