mannan-binding lectin serine peptidase 2 (MASP2) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the MASP2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering MASP2 transcript NM_006610.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CAGGCTCACAGACTGGGAGTGATTTTTCTCCTTTGGAGCTCGTCCAGAATCCATCAGCCT       c.60
 Q  A  H  R  L  G  V  I  F  L  L  W  S  S  S  R  I  H  Q  P         p.20

          .      | 02  .         .         .         .         .    g.617
 CACACACATATTTAC | CATCATTCACTTTCATTGTGTAGAAGGTCTCTTCACAGCTGTACT    c.120
 H  T  H  I  Y   | H  H  S  L  S  L  C  R  R  S  L  H  S  C  T      p.40

          .         .         .                                     g.656
 GAATCACAGCTTTGTAGGTGGTCACTCCAGGACCTGTGA                            c.159
 E  S  Q  L  C  R  W  S  L  Q  D  L  X                              p.52

          .         .         .         .         .  | 03      .    g.4661
 tgtactccactcggccactgggtagatcatcaggagggccacagtcaacaa | tgctgcacg    c.*60

          .         .         .         .         .         .       g.4721
 cgggcattggccggtcccaagatccatctttctgacaaactgcagtaaaggatttcaggg       c.*120

          . | 04       .         .         .         .         .    g.7567
 gcaagtgacc | ttgcagaagctcatagccagtctcgcaaaagatggagaagctgtctttca    c.*180

          .         .         .         .         .         .       g.7627
 ggatgtatttggcttgcacaggtgaaacgtggccattaggtggcgccatcggataagggc       c.*240

           | 05        .         .         .         .         .    g.12750
 aaggctgcg | ctgtgctcgtgtagtggatcttccagcctgtgtggtctcctgattcatctg    c.*300

          .         .         .         .         .         .       g.12810
 tgacaaaggtgatggtcaccgtgttgctttttgtttcaatcctgtggggcaatgtcttcc       c.*360

          .         .         .        | 06.         .         .    g.13186
 cacagaatgggccatgttcttctctgtctgtttgaat | cttgagaaagtcgtagggacaca    c.*420

          .         .         .         .         .         .       g.13246
 gggtttcagggtgtgtctccacatcgaaggactccacaaagtccagaatgacactgaacc       c.*480

          .         .         .         .         .         .       g.13306
 cctcctccaggctgatgctgtaagtgcaactggagagtttgggatacggccgtgggtatt       c.*540

          .         .         .         .         .     | 07   .    g.15238
 cagggctgctgagctccccagacctctgggtgaagacctggccggagcacaggg | ctgagc    c.*600

          .         .         .         .         .         .       g.15298
 aggtgcgcttgttacggtgcaggacgtagcctgcgcggcaggagcagtagaaaccgccca       c.*660

          .         .         .         .         .         .       g.15358
 ggtggttgtggcagtggtggtcgcaggtgggcgcctctcccggggccacctggcactcgt       c.*720

        | 08 .         .         .         .         .         .    g.16434
 caatgt | cctcggctgcatagaaggcctcgaaccccgtgaacggcttctcgttggagtagt    c.*780

          .         .         .         .         .         .       g.16494
 cggagcggaaggtaatgtccaggctggagcccagcgagtagaaagtgtccttgccagggg       c.*840

          .         .         .         .         .         .       g.16554
 cccgctccgtgtctgtgctctcctgcccgcacagcgtggccagcaccttggcccccgagc       c.*900

      | 09   .         .         .         .         .         .    g.16771
 tcag | cttgacgaagtcgtactcgcagaggtgggagagctccaggtcgaagtgggtgaagt    c.*960

          .         .         .         .         .         .       g.16831
 agaggcgcaggcggtagccggggggtgcagtcagggtccagcgccgctcctggtcattgg       c.*1020

          .         .         .         .         .         .       g.16891
 catactcccctggaaagccgggggatgccaggcgcccgaacacaggttcaggccacttcg       c.*1080

          .         .         .         .         .    | 10    .    g.17034
 ggcccaagggggtggccaccgagccacacagaaggcccaggagggtcagcagc | ctcatgg    c.*1140

          .         .         . | 11       .         .         .                                 g.17094
 tgtgcccgtccagctggcctggcctggtct | t                                 c.*1171

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Mannan-binding lectin serine peptidase 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.