Mediterranean fever (MEFV) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the MEFV gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering MEFV transcript NM_000243.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .    | 02                             g.421
 CAGCATGTGCCTGAGCGCCAATCAGCTCCGGAA | CATTGA                         c.39
 Q  H  V  P  E  R  Q  S  A  P  E   | H  X                           p.12

          .         .        | 03.         .         .         .    g.667
 acatttccatttctgaacgcagggttt | ctgagaagtactttgtgctcttctccacaaact    c.*60

          .         .         .         .         .         .       g.727
 ctgacttctggtggaggagttggatcttttgttttatctcttgaggagtggtccactttt       c.*120

          .         .    | 04    .         .       | 05 .         . g.3191
 cagggacaggcactgtcttagcc | ctgtgcaagatgtctccaatgtc | ctgcagaagttccc c.*180

          .         .         .         .         .         .       g.3251
 attctgactggcactccttggcctccagttccccaatcagcgcatcgagcagggcgatgt       c.*240

          .         .         .         .         .         .       g.3311
 cctgggatacgcgggtgtcatatgccttcctgatctgcccaaccatctggcccacgtcct       c.*300

          .         .         .         .         .         .       g.3371
 ccagtgaggccacaaagaaatgctcttgctgctccaggaagtagtacacctgctccagct       c.*360

          .         .         .        | 06.         .         .    g.5093
 tcctctgcacccgctgcttcagcgcttcagtttgttt | cagaaagctcactgccttctcct    c.*420

          .         .         .         .         .         .       g.5153
 ccccataggatcgctgctcctcccctgattttctcagcttcttcagatgctccagctgct       c.*480

          .    | 07    .         .         .         .         .    g.5639
 tctgaattttctt | cttgtgttccagggcgacctcctcaatggggcgcacccggtggcctt    c.*540

          .         .         .         .         .         .       g.5699
 ggtgctcctgactcagactgcagatgaggcagatgggctcatcgtgatcctcacagaaga       c.*600

          .         .         .         .         .         .       g.5759
 gcagctggacctgcttcaggtggcgcttacactgtggcaggggctgggggcttaggcttc       c.*660

          .         .         .         .         .         .       g.5819
 ccgggctcttcctttcatgggagtcctggcaccgggggcagccaggtgagcggctgcctg       c.*720

          .         .         .         .         .         .       g.5879
 aggcctgggggtgcccagaaactgcctcggggaagctgcaggaatcacgcacacaggtac       c.*780

          .         .         .         .         .         .       g.5939
 cgtcaactgggtctccttcctgggcgtggcagcggggactcgcagccgtgtctggtggcc       c.*840

     | 08    .         .         .         .         .         .    g.10376
 ttc | cggtgaccgaatgttctggatttccagggccttccttcaggtccgcagatgcccctc    c.*900

          .         .         .         .         .         .       g.10436
 catccggagtgggccttgcccggggttctgttgccgagtccagattcgcagctgtctttt       c.*960

          .         .         .         .         .         .       g.10496
 cctctagagtcaggagaatttctggatttgcgggcgccttctcccctgtagaaatggtga       c.*1020

          .         .         .         .         .         .       g.10556
 cctcaaggcttctaggtcgcatctttcccgagggcaggtacacttcgaagggcctgcact       c.*1080

          .         .         .         .         .         .       g.10616
 ccttctgccccggggcgccccccgccagcccctgcagcctccccgcggagctggcgtttc       c.*1140

          .         .         .         .         .         .       g.10676
 tgcgcagccggacctcggcctggcccccctctagcgccctgcaggggccggggcttctcc       c.*1200

          .         .         .         .         .         .       g.10736
 cgcccggcagggccgggctccgggtccgaggcttgccctgcgcgtccaggccctccgagg       c.*1260

          .         .         .         .         .         .       g.10796
 ccttctctctgcgtttgctcaggggcttcctcgacagccccctcccggcctcgggctggc       c.*1320

          .         .         .         .         .         .       g.10856
 tgcaccgcaggctggcagctccgcccccgtacggccgagggccgttcccctcgttcccct       c.*1380

          .         .         .         .         .         .       g.10916
 cggggtggtctggagtcttcaggctcctgggcttgttctcccccagggagctggacgctg       c.*1440

          .         .         .       | 09 .         .         .    g.12496
 cggaatcatctgtgccgttttcttgtgtggaatatt | cctgaatggctgccctgtggagct    c.*1500

          .         .         .         .         .         .       g.12556
 cctcggccagcaggcgctggttgatggcccgcaggacctgcagggtgagctgcacggcgt       c.*1560

          .         .         .         .         .         .       g.12616
 actcttccccatagtaggtgaccagcagagtggccatcttcaccggcctggctctctgga       c.*1620

          .         .         .         .         .         .       g.12676
 tctggctccgggggatcctggagtgctccttctgcacactggtgttctgcagcttgaact       c.*1680

          .         .         .         .         .         .       g.12736
 tgaacttctcgaagtcatagggcaccagctcctccagggtggacagcagatggtcactag       c.*1740

          .         .         .         .         .    | 10    .          g.12796
 gggtcttagccatggtgctgagcaggagaggctcgagccagctgtctggcttc | a          c.*1794

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Mediterranean fever protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.