nibrin (NBN) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the NBN gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000008.10, covering NBN transcript NM_002485.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .                       g.42
 CTAAAAAGATCATCAGCAAGAGACTCTTCTTTTGCATGTTGA |                      c.43
 L  K  R  S  S  A  R  D  S  S  F  A  C  X                        p.13

          | 02         .         .         .         .         .    g.6279
 ttttgtac | ctccatttcctgccttagccactcttctagttctgtattctttcgagcatga    c.*60

          .         .         .         .         .         .       g.6339
 tgagctattagatctgatcctccaatgatgtgtggaagttttcctgctccaggatatgtg       c.*120

    | 03     .         .         .         .         .         .    g.9172
 ac | ctttttgaatttcttgaaattttttagttgaccataatcatcatttatgccagatgga    c.*180

          .         .         .         .         .         .       g.9232
 tttctggaagtagagtttttaatcaccagtgatctaaattcagtcaataacagctttttt       c.*240

          .         .         .         | 04         .         .    g.10820
 ggaagcatctcactatcatcctgaagtttgtcattgtt | agatatttctttagctgaccat    c.*300

          .         .         .         .        | 05.         .    g.16231
 agtgagtcttccttgagttcacgtttcttcccaatttcattttcttg | agatattttgcta    c.*360

          .         .         .         .         .         .       g.16291
 ctttctggtactgcttcatcactgaaagtgtcatttgtttctatatccatccttggcctt       c.*420

          .         .         .         .         .         .       g.16351
 tttctaacattgacatcttcctcctgtttttgaactttcacatcaatttctaactctggt       c.*480

          .         .         .         .         .         .       g.16411
 tttgtgtccttgaataactgttccaatacttcatcttctatggccacatcatccatttcc       c.*540

          .         .         .         .         .         .       g.16471
 ctttttttatttgatcttagcttttctgcagcatgagatttactggcagaatttttcaca       c.*600

          .         .         .         .         .         .       g.16531
 atagattttaaatctgtatctgtaaataagttattgtctgagtttgtgtccacaggctca       c.*660

          .         .         .         .         .         .       g.16591
 ttctcagatagatgctgctccttatttttccacaatgagggtgtagcaggttgtgtttgt       c.*720

          .         .         .         .         .         .       g.16651
 tctaaaagagaacaagacgtttctattcttgctgatttgcatgaagacatttcttgattt       c.*780

          .      | 06  .         .         .         .         .    g.18302
 tcttcatccctttcc | ctttttttggtagacggctgaaagtagtttctgatggagttggtc    c.*840

          .         .         .         .         .         .       g.18362
 tgctgctgctgagaagccctatctttacttttatttatacttggcaatttagttggtgaa       c.*900

          .         .         .         .         .         .       g.18422
 agctgatagtttgggattctcatcttagccaaagtatttgataccatactattattatta       c.*960

          .         .         .         .         .         .       g.18482
 gagcttgttttgcaggactcctttacagtgggtgcatcttgtgaaagcattctgaatttt       c.*1020

          .         .         .         .         | 07         .    g.21711
 tgttccattttggagactttgatttcttttggcctttcactcaaatcc | catgtatctgct    c.*1080

          .         .         .         .         .         .       g.21771
 tgctctgattctgtgtcagctacgtatgttgtagtgttcactggggcgcttggcattagt       c.*1140

          .         .         .         .         .         | 08    g.27386
 ttttcatcaactgacacgccttgtgaaaggcttggtcctggagttgttgtctttaatc | ct    c.*1200

          .         .         .         .         .         .       g.27446
 gtactgggatggccctgaggatcacagtaattctttgtagtcatgaaaatcaccgccaat       c.*1260

          .         .         .       | 09 .         .         .    g.33362
 ccaatttctgcttcaggaataggtctaagaccttgc | ctttggagcatatccattattgac    c.*1320

          .         .         .         .         .         .       g.33422
 tgaatccatttcttctgacagtcaggaattaaggtctgtgagtttgttattcctgtatca       c.*1380

          .         .         .         .         .         .       g.33482
 acaacacacgttcccggagccaaaaagaaattatgttcttcttcattctcttctgttatc       c.*1440

          .         .         .         .         . | 10       .    g.34157
 aacctagcttccccacctccaaagacaactgcggaactcaatttcttatg | ctgtttggca    c.*1500

          .         .         .         .         .         .       g.34217
 ttcaaaaatataaatgttttccctttgaagatttgttttctttcctgccgtcctgacaga       c.*1560

          .         .         .         .         | 11         .    g.41206
 tcaacatttttacttccaatagatggttcatcaagaggtgggtaaaaa | ctttcaatttgt    c.*1620

          .         .         .         .         .         .       g.41266
 ggaggctgcttcttggactcaactgctttcaggaattcagtaaaatattctggctttaca       c.*1680

          .         .         .   | 12     .         .         .    g.43736
 attggacgtccacaaatgagtgcacatattgt | tttaatggtaactttcactgataccatg    c.*1740

          .         .         .         .         .         .       g.43796
 acaaggtgagtgcattcttctgtccaattgtttacagtaaatcctccaagttgcaatata       c.*1800

          .         .         .         .         .         .       g.43856
 gcttgatttaaagcagttttcccagagacatctaaacaagaagagcatgcaaccaaaggc       c.*1860

          .   | 13     .         .         .         .         .    g.44397
 tcatactctatt | ctgaatttacttccaaacactccaaaagtaataccatcccccgacttc    c.*1920

          .         .         .         .         .         .       g.44457
 aaagttcgggaaaagccattctgcattttttcctcattaacaaaggtaccatacttagaa       c.*1980

          .         .         .         .  | 14      .         .    g.45715
 ttatcttttaatgtcaatacagggatttcatctgtttgact | caggttggttacagaaaag    c.*2040

          .         .         .         .         .         .       g.45775
 ttagcagttaacacagcatgatttcggctgatcgactgatcattttcaatcagaatggca       c.*2100

          .         .         .         .         .      | 15  .    g.47504
 cagtttttccttccaacaacgtactcaacgccagtcaaaagtctgtatggttctc | ctcct    c.*2160

          .         .         .         .         .         .       g.47564
 gccgggcccgcggcgggcagcagtttccacatcggtccggctcctcagggctggggccga       c.*2220

          .         .         .         .         .         .       g.47624
 cgtgcaaccgcgtaaccggggctgctagacgagcgcggatacggcgcctgcggtcggcat       c.*2280

          .         .   | 16     .         .         .         .                                         g.47684
 gggctccgggacgtgcgcgctc | c                                         c.*2303

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Nibrin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.