neutrophil cytosolic factor 2 (NCF2) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the NCF2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering NCF2 transcript NM_000433.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CCTTTGATAACACCAGGATTATATCCCCTTCCTGAAACTCCAGGTCCTCTGGTTGGGTAG       c.60
 P  L  I  T  P  G  L  Y  P  L  P  E  T  P  G  P  L  V  G  X         p.19

          .         .         .         .         .         .       g.120
 cctcataactgaagagtgcctccacttggctgcctttcttaagctgaggttctgttgtct       c.*60

          .         .         .         .         .         | 02    g.3101
 ggttattagcatcagctttttcactttccttgggttcatctggaaagccttggtcacc | ca    c.*120

          .         .         .         .         .         .       g.3161
 ctgtgttctcacaccacagagtcaggcagtagtttttcacctggccccaggcatccttca       c.*180

          .         .         .         .         . | 03       .    g.3348
 tgctgtcttctgaaaggggcaccagctcattgctgtcccgaggccgatag | ctcagcttag    c.*240

          .         .         .         .         .         .       g.3408
 tgtgttccagccggagctccagtttcttagacaccatgtcccggacctggctgtagggga       c.*300

          .         .         .         .         .         .       g.3468
 gcccgggctgagtcttcatgactaccgtgtacttgtagtgcaccttgagtgtgtagggca       c.*360

          .         .   | 04     .         .         | 05         . g.5620
 tgggaacactgagcttcacttc | cttaggctcttctttttgtttctggc | ctggtgacagct c.*420

          .         .         .         .         .         .       g.5680
 ggggtcttccaggggctttggaactaggaggagctgggatgtcggactgcggagagcttt       c.*480

      | 06   .         .         .         .         .         .    g.6880
 cctc | ctggggctgctgctgagggtggatccgcagctcaactggttcaaggtagttgcagg    c.*540

          .    | 07    .         .         .         .         .    g.7155
 gaacaagcccctt | ctgcccgttgaacatgaccgtggcccagttatcattgcccttcttca    c.*600

          .         .         .         .         .         .       g.7215
 agacaaagacaatgttccctggcatgacctggagctcttcttttgtctcaggcacaaacc       c.*660

          .         .         .      | 08  .         .         .    g.9071
 caaatagcacacggtgagcctccccttccagagcc | ctgaagatctctggggttttcggtc    c.*720

          .          | 09        .         .         .         .    g.10725
 tgggtggaggctcagctgc | ctgtggttgcagaggggcaaacccagagaaactgtcttgat    c.*780

          .          | 10        .         .         .         .    g.13130
 ccaccacagatgccacgac | cgtcgccttgcctaggtaatccttcttggccagctgagcca    c.*840

          .         .         .         .         .         .       g.13190
 cttgtctctcatttggtcgaaacagcttgcccacagggatcaccactggctcatatagct       c.*900

         | 11.         .         .         .         .         .    g.14444
 tctgctt | ccagacacactccatcgccttgtcgattttggaatgtctgggctcagacttca    c.*960

          .         .         .         .         .         .       g.14504
 tgctcgtggccaatgctaactgttcttcagcttttttccattcctccttcttggcataca       c.*1020

          .         .   | 12     .         .         .         .    g.17541
 tgaaagcaatgttatataacac | ctcacaggcaaacagcttgaactggagccccaggatct    c.*1080

          .         .         .         .         .         .       g.17601
 tatagtctatcagctggttccctcgaagctgaatcaaggcttctttaaggtctttgatag       c.*1140

          .  | 13      .         .         .         .         .    g.26848
 ccaaatcatat | ttctctgtctggtagtagagcatccctcgttggaagtaagccactgcca    c.*1200

          .         .         .     | 14   .         .         .    g.30086
 agtgcttgtctcggttaatgcttctggtaaaggc | cttctctgcttcagtcatgttcttca    c.*1260

          .         .         .         .         .         .       g.30146
 ggatagtgtacatgcagccaatgttgaagcaaatccgggagtgggggtcctggacggcac       c.*1320

          .         .         .         .         .         .       g.30206
 tgaaggcatccagggctcccttccagtccttcttgtccgctgccagcaccccttcattcc       c.*1380

          .         .         .         .         .         .       g.30266
 agaggctgatggcctccaccagggacatgattaggtagaaactaggaggccaagagagct       c.*1440

          .         .         .         .         .         .       g.30326
 gccaggagacagagagaagacaggttggagcgtctcccctagcagggctgccttagtggc       c.*1500

          .         .         .         .         .         .       g.30386
 ccccaaggtgttcactttctgggccagatgagtagaatggggcccagcctcccttaagat       c.*1560

          .         .         .         .         .         .       g.30446
 aacttctcagtgttgcaaatgcatcaggaaatgtccccaccttttggcaactgactcata       c.*1620

          .         .         .         .         .         .       g.30506
 accctaccatgagagagaaaaggaaagaagcagagagagagagggcgagtaggggtggag       c.*1680

     | 15    .         .         .         .         .         .                                                            g.30566
 tgt | t                                                            c.*1684

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Neutrophil cytosolic factor 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.