nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (NFKBIA) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the NFKBIA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000014.8, covering NFKBIA transcript NM_020529.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .                                     g.30
 CTCGTCCTCTGTGAACTCCGTGAACTCTGA                                     c.30
 L  V  L  C  E  L  R  E  L  X                                       p.9

          .         .         .         .         .         .       g.90
 ctctgtgtcatagctctcctcatcctcactctctggcagcatctgaaggttttctagtgt       c.*60

          .         .         .         .         .         .       g.150
 cagctggcccagctgctgctgtatccgggtgcttgggcggccccaggtgagctggtaggg       c.*120

          .         .         .         .         .         .       g.210
 agaatagccctggtaggtaactctgttgacatcagccccacacttcaacaggagtgacac       c.*180

          .         .         .         .         .         .       g.270
 caggtcaggattttgcaggtccactgcgaggtgaagggcagtccggccattacagggctc       c.*240

  | 02       .         .         .         .         .         .    g.437
  | ctgagcattgacatcagcacccaaggacaccaaaagctccacgatgcccaggtagccatg    c.*300

          .         .          | 03        .         .         .    g.787
 gatagaggctaagtgtagacacgtgtggc | cattgtagttggtagccttcaggatggagtg    c.*360

          .         .         .         .         .         .       g.847
 gaggtgcggggtggtgcaggactgagtcaggactcccacgctggccaggcagccctgctc       c.*420

          .         .         .         .         .         .       g.907
 acaggcaaggtgtaggggggtatttcctcgaaagtctcggagctcaggatcacagccagc       c.*480

          .         .         .         .         .         .       g.967
 tcccagaagtgcctcagcaatttctggctggttggtgatcacagccaagtggagtggagt       c.*540

  | 04       .         .         .         .         .         .    g.1356
  | ctgctgcaggttgttctggaagttgaggaaggccaggtctcccttcacctggcggatcac    c.*600

          .         .         .         .          | 05        .    g.2035
 ttccatggtcagtgccttttcttcatggatgatggccaagtgcaggaac | gagtccccgtc    c.*660

          .         .         .         .         .         .       g.2095
 ctcggtgagctgctgcttccagggctccgagccgcgcggcacctcctgcggctcgaggcg       c.*720

          .         .         .         .         .         .       g.2155
 gatctcctgcagctccttgaccatctgctcgtactcctcgtctttcatggagtccaggcc       c.*780

          .         .         .         .         .         .       g.2215
 gctgtcgtggcggtcgtccagtagccgctccttcttcagcccgtcgcgggggccctccat       c.*840

          .         .         .         .         .         .       g.2275
 ggcccactcctgggggcgctcggccgcctggaacatggcgcggacgagctgcgggcgctg       c.*900

          .         .         .         .         .         .       g.2335
 ctgcgggtgcgctgggccgcgggctgcgcgctgcttcctcgctggggcgctggcgggcgg       c.*960

          .         .       | 06 .         .         .         .                                     g.2395
 gacggcggcacggactgctgtgggct | a                                     c.*987

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.