nonhomologous end-joining factor 1 (NHEJ1) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the NHEJ1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering NHEJ1 transcript NM_024782.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .                                               g.24
 CGTGGACTCTTTCTCAGGTGCTGA                                           c.24
 R  G  L  F  L  R  C  X                                             p.7

          .         .         .         .         .         .       g.84
 gagggttggggctgaggagaccagttgttctggctggtttacacattggctatcgattcc       c.*60

          .         .         .      | 02  .         .         .    g.868
 ttgcagggaagcactgtttgaggtatgaggatctc | cagcgccttgatgcttctgtcccac    c.*120

          .         .         .         .         .         .       g.928
 ttggacctcttgtgtggtgactgccatatacagatcctgcagattcatgacaaagggctt       c.*180

          .         .         .    | 03    .         .         .    g.69461
 tccatcaccaatgctgcatgcctctggcagttt | ctctatcataaattgttccaagaagga    c.*240

          .         .         .   | 04     .         .         .    g.70439
 attttcttcaaatggttctgtcttcaatcgat | ctcgaatcagcgtagccccactctcctg    c.*300

          .         .         .         .         .         .       g.70499
 gtagtcttggatctctaggtctttcatatgaagtaacgttgctagctccctcacttggca       c.*360

          .         .         .         .         .  | 05      .    g.80235
 ctgtaatgccagactcatgcccatcagaggacgaatcaaatgttgggagac | cagggaagg    c.*420

          .         .         .         .         .         .       g.80295
 actagctagcatgcagtggaaattccaatagaaggggaggccagagagctcacttcgcac       c.*480

          .         .         .         .         .         .       g.80355
 ccgtagaatcagtgcatctgccacacaatcacaggagaaggtagcttcgctagggtgagc       c.*540

          .         .         .         .         .         .       g.80415
 agcgtccttcaacaatgggcgaaggagattatccaaatgacagaggaaagctgcaggagg       c.*600

          .         .     | 06   .         .         .         .    g.80976
 agcagtgagccgcttgttcagctc | cttggctcgctggctgaccacactagtgtccacctg    c.*660

          .         .         .         .         .         .       g.81036
 ttcatgccacacctgttgaagatctgaaaccaacaaggcatagccctgcttggtgataaa       c.*720

          .         .         .         .         .         .       g.81096
 aaccttggccaagagggagttctctgcaagctgtagccacgcccatggctgcatcaacag       c.*780

          .         .  | 07      .         .         .         .    g.83513
 gccttgctccagttcttccat | cgtcagcggccgcgagagcgcccactctcttagccgcac    c.*840

          .         .         .         .         .         .       g.83573
 gcacgctttcctgcccgctcgcgcaaaccgaaaggcctagagtaagaggccgctttcccc       c.*900

          .         .         .         .        | 08.         .                g.83633
 ccaccgcaagaggaggcagggtcttgggatacaggggcggggcctat | a                c.*948

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Nonhomologous end-joining factor 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.