NHP2 ribonucleoprotein (NHP2) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the NHP2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000005.9, covering NHP2 transcript NM_017838.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CGTCTTAGAGGGGATATAGACATAGGGCAAATTTCGGTCCTCACACATGACTGGGAGATG       c.60
 R  L  R  G  D  I  D  I  G  Q  I  S  V  L  T  H  D  W  E  M         p.20

          .         .         .         .       | 02 .         .    g.2617
 GCAGTATACCTCAATGGGCAGTGTGTCTCCTGCCAAAACCATGATC | CCTTTTTCTCCTTT    c.120
 A  V  Y  L  N  G  Q  C  V  S  C  Q  N  H  D  P |   F  F  S  F      p.40

          .         .         .         .         .       | 03 .    g.2774
 GTTGACAAATTTCTGAACCTCTTTCACCCCGCGCCGAATCTGCTTCTGCTTCACCG | CTTT    c.180
 V  D  K  F  L  N  L  F  H  P  A  P  N  L  L  L  L  H  R  |  F      p.60

          .         .         .         .         .         .       g.2834
 CTTGATGCATTTGTAGAGCTTCCGCGTGAGGCGGCGAGAAGCCAGGGGCTGCGCGATGGG       c.240
 L  D  A  F  V  E  L  P  R  E  A  A  R  S  Q  G  L  R  D  G         p.80

          .         .         .         .         .         .       g.2894
 GTTCTGGTTGACCAGCAGCTCCTGGTAGGTGCGCTCCCCGGAACACGCCTCCGCCTGAGC       c.300
 V  L  V  D  Q  Q  L  L  V  G  A  L  P  G  T  R  L  R  L  S         p.100

          .         .         .         .         .                 g.2945
 CTCGGGCCCGTCGGGATCTGCCTTTATTTTGGTCATCGCAGCGGCCGCTGA                c.351
 L  G  P  V  G  I  C  L  Y  F  G  H  R  S  G  R  X                  p.116

          .         .         .         .         .         .       g.3005
 aacctagtcccagggaggcgagcccacgcggtccacagctttaggcatcacttccaggtc       c.*60

          .         .         .         .         .         .       g.3065
 atcagctgcgcgagaagccgccgtacaacacggccaatcaggaaaggaagtctccgactc       c.*120

          | 04         .         .         .         .         .                                                       g.3125
 agcccaat | a                                                       c.*129

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The NHP2 ribonucleoprotein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.