NOP10 ribonucleoprotein (NOP10) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the NOP10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000015.9, covering NOP10 transcript NM_018648.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTCAGCGTATAGACTCGATCTCCCTGCTCGTTGAGGTAATACTGGAGAAACATGATCGC       c.60
 L  Q  R  I  D  S  I  S  L  L  V  E  V  I  L  E  K  H  D  R         p.20

                                                                    g.66
 TTATAA                                                             c.66
 L  X                                                               p.21

          .         .         .         .         .         .       g.126
 gccagcggtcccaattcggtccaccgctcagtctgcagtggtccgcccgaccgcgtcacg       c.*60

          .       | 02 .         .         .         .         .                                               g.186
 tgttcgtcaatttcct | t                                               c.*77

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The NOP10 ribonucleoprotein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.