phosphatidylinositol glycan anchor biosynthesis, class A (PIGA) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the PIGA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering PIGA transcript NM_002641.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTTTCAGTTCTTTCTGCAACATTCCTCCAGGTGTAGAAAGTCTTTACTATGTTATGGAT       c.60
 L  F  S  S  F  C  N  I  P  P  G  V  E  S  L  Y  Y  V  M  D         p.20

          .         .                                               g.87
 GTTTTCTGGAGCTGGCAATGTCCCTGA                                        c.87
 V  F  W  S  W  Q  C  P  X                                          p.28

          .         .         .         .         .         .       g.147
 cttcagttggaaaatagccttttccaatccttcacacaaagattttactgaaggctcaca       c.*60

          .         .         .         .         .         .       g.207
 taaaataataaggttttctggaagcacctcaggaattccaccaactctggtacttacaac       c.*120

  | 02       .         .         .         .         .         .    g.415
  | ctgtaaaccacaactggctgcttccacgatcgccatgcagaatgcttcagtaagggaggt    c.*180

          .         .         .         .         .         .       g.475
 attcagaaaaatatgtccttgaactaagacatttctaacatccttgtgttctaaagctcc       c.*240

          .    | 03    .         .         .         .         .    g.1296
 caaaagacgcacc | ctgtcatgcagctggtatctttcccgaacttcttccaaaatgattct    c.*300

          .         .         .         .         .         .       g.1356
 ctttggtccctctcctccaattatgaaatttaaatctggatatttctgacagagttcagg       c.*360

          .         .       | 04 .         .         .         .    g.6585
 tattataccactaagcaaatcgatcc | cttttctgtaaacaagtctgctgacaacaacaat    c.*420

          .         .         .         .         .         .       g.6645
 agttatactatcatgccttctaaatgggtctggagtgaagtcagtaggatctacagcatt       c.*480

          .         .         .         .         .         .       g.6705
 aggaatgacggacactatttcaggattcagtgctgctcttagtacagtattttccttact       c.*540

          .         .         .         .         .         .       g.6765
 agtataagacacacaaatgatgtggtttgtatcacaaagagacacggttagaagcttgtt       c.*600

          .         .         .         .         .         .       g.6825
 tgtaagcaccgagctgacatcagcaaatccaaaaagggaatggtccgtgaagactgtctg       c.*660

          .         .         .         .         .         .       g.6885
 aagccccattgtcttggcgtggaagagagcatcatgggccatagcagaaaaagaactatg       c.*720

          .         .         .         .         .         .       g.6945
 tgaatggattatcgtgactctctcccgaacaaatatgtacctgagcaatggcagactgtg       c.*780

          .         .         .         .         .         .       g.7005
 aaagagggtcgtggctgtagactggttgtacatgactttcagaggcaagtaatagacttt       c.*840

          .         .         .         .         .         .       g.7065
 gaggccactggtgaggtaacggatgccttttcgatttccataagcatgggtgacaattat       c.*900

          .         .         .         .         .         .       g.7125
 aaccttatgccctctttcaatcaggcactgagagagctggtaaatgtggctttccacgcc       c.*960

          .         .         .         .         .         .       g.7185
 tcccatatttgggtagaaaaagtcagataccatgcatatattatgggtacgggttctaca       c.*1020

          .         .         .         .         .         .       g.7245
 tgtgtaaagacttccagggctaacccgagagagtgtagctgaggcacggtggccattccc       c.*1080

          .         .         .         .         .         .       g.7305
 agctcctcctctacaggccatgctgagacggtttagacatcagttcttagagcaacccag       c.*1140

          .         .    | 05    .         .         .         .    g.10873
 ttaagagatgtgtcctctattac | cggtgagttccatggccgccagtgtccggacctcccg    c.*1200

          .        | 06.         .         .         .         .                                              g.10933
 cggctgcagccggagtc | t                                              c.*1218

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Phosphatidylinositol glycan anchor biosynthesis, class A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.