PMS2 postmeiotic segregation increased 2 (S. cerevisiae) (PMS2) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the PMS2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering PMS2 transcript NM_000535.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CGACTTCCGGCAGGCTCTGGAGGCAAACATCTGCTTGACTCGGGAAGGCCGGCACATGAC       c.60
 R  L  P  A  G  S  G  G  K  H  L  L  D  S  G  R  P  A  H  D         p.20

          .         .         .         .         .         .       g.120
 CCCAGGGCTGTCGCTCAGCATGAAGATCAGTTCATCGACGTCCTGGGGTCCGAAGGTCCA       c.120
 P  R  A  V  A  Q  H  E  D  Q  F  I  D  V  L  G  S  E  G  P         p.40

          .         .         .         .         . | 02       .    g.1018
 GTTTTTACTAGTTGGCAAGGAAATCAGTTTAGCCCTTTCAGTGACTGGAG | CATTTTCATC    c.180
 V  F  T  S  W  Q  G  N  Q  F  S  P  F  S  D  W  S  |  I  F  I      p.60

          .         .         .         .         .         .       g.1078
 GATAACAAAATCAAAGCCATTCTTTCTAAATATTTCCAGATTTTCTATCAGAACAGCTTC       c.240
 D  N  K  I  K  A  I  L  S  K  Y  F  Q  I  F  Y  Q  N  S  F         p.80

          .                                                     g.1093
 ATTAACAGCAGTTAA |                                                 c.256
 I  N  S  S  X                                                   p.84

          .       | 03 .         .         .         .         .    g.5280
 gttgagagtctgaggt | gctatgagcctctgcccctggagcacggtgtgctgctgcagcat    c.*60

          .         .         .         .         .         .       g.5340
 ctcgaagttatacttctcgtccgtggcatgctggtccactatgaagatatcctcattcag       c.*120

          .         .         .         .         .         .       g.5400
 tttggttattataaatcccaggttaaactgaccaatgatttccatttctgcaaacatcgt       c.*180

      | 04   .         .         .         .         .         .    g.9227
 ttta | cttatctcttttcttagttcatcttcggctgcttgattttctccaggacaaatctt    c.*240

          .         .         .         .         .         .       g.9287
 tgccctaaacttcctgtaattctgttccccttcactttgctgtgcttcatgatgtaactg       c.*300

          .         .         .         .         .         .       g.9347
 ctttattcgtttagctaaagaactcatagaaaagtccaggggcacaactttcttattaat       c.*360

          .         .         .         .         .         .       g.9407
 tttcacagctacatcaacctgagaggctgacatgtcctgagtatttactaacttttgaca       c.*420

          .         .         .         .         .         .       g.9467
 aatgtcagaactggaaagaatttcttcttttttaaaacgctttgtgtttggggttgcgag       c.*480

          .         .         .         .         .         .       g.9527
 attagttggctgaggcaaaactcgaaatttacatccggtatcttcctggtttgaatggca       c.*540

          .         .         .         .         .         .       g.9587
 gtccacatctgaaaaagagtcgtcagttttaggcgctttctcctgagagtccacatgttc       c.*600

          .         .         .         .         .         .       g.9647
 ctgcgagcccctgtcccctggggagctggccgcatactcgctgctgcagtgactgcccgt       c.*660

          .         .         .         .         .         .       g.9707
 gtctgggatgctgaacccctcagaatccacggaagtgctgccgtgccccgagtccttctc       c.*720

          .         .         .         .         .         .       g.9767
 cacctccgctctgtccgtagggtcactgggtccgtgactggaactcactgcctctttctg       c.*780

          .         .         .         .         .         .       g.9827
 aggtctcaggacgcctttgtcagagatggcacctgaagtgctagaagacagcatacccct       c.*840

          .         .         .         .         .         .       g.9887
 tttctgtcctagagggctccttcttggttctggagtctttgggctgtgaggcttgttctc       c.*900

          .         .         .         .         .         .       g.9947
 tgttgtgtgacgaagagaaaaggcctctcgcagtctggaaatggacacgtcttttttttc       c.*960

          .         .         .         .         .         .       g.10007
 ttctccagtccttaatgaaggggattgatcctgcttttctaccatgggcttttccaaatc       c.*1020

          .         .       | 05 .         .         .         .    g.12246
 cgctgcatgcatttttattaagttac | cttcaacatccagcagtggctgctgactgacatt    c.*1080

          .         .         .         .         .         .       g.12306
 tagcttgttgacatcactatcaaacattcctatcaaagaggtctttaaaactgccaacaa       c.*1140

          .         .         .         .         .         .       g.12366
 aagcttttcctcttgtagcaaaatttgccttttatctggagtaacattgatatcaacgca       c.*1200

    | 06     .         .         .         .         .         .    g.14443
 tt | ctgaatcaacagaaatgttaagaacaacaaatggatactggtgtcgattatacatgtg    c.*1260

          .         .        | 07.         .         .         .    g.17979
 gtagacctcattcacgagtctgcagac | ctttgctgggtcacaaggccgccggttgataaa    c.*1320

          .         .         .         .         .         .       g.18039
 gaaaaactgtctgtctgttgaactccttccaactccatgcgtgcattgtgaaatgaaacc       c.*1380

         | 08.         .         .         .         .         .    g.19791
 tgagatg | taaaaaagattatgcagagcatcggaacagctcaaaccgtactcttcacacac    c.*1440

          .         .         .         .      | 09  .         .    g.21535
 ggagtcactagggggcagctgaacaaaaggaatgaggctttgcaa | ctgcttctgcccaaa    c.*1500

          .         .         .         .         .         .       g.21595
 cacagagccgatattttcctttatgctggggcttccacctgtgcataccacaggctgtcg       c.*1560

          .         .         .         .         .         .       g.21655
 ttttccttgtccaagctgattggtgcaacttacacggatgcctgctgaaatgatacagta       c.*1620

          .         .         .    | 10    .         .         .    g.24892
 tgcatgtaagacctggaccattttggcatactc | cttcttaatattcctttgaaattcctt    c.*1680

          .         .         .         .         .         .       g.24952
 atggcgcacaggtagtgtggaaaataactgctgcacgctgactgtggtccctctggggcg       c.*1740

          .         .         .         .         .         .       g.25012
 ggggtagggggttttctggataattttcccattgtgatcaaacatcagtcgagttccaac       c.*1800

          .         .         .        | 11.         .         .    g.26125
 cttcgccgatgcgtggcaggtagaaatggtgacatcg | ctcagtgcacaaagtgagctcag    c.*1860

          .         .         .         .         .         .       g.26185
 agcttccccccgaaagccaaaagtttcaacctgagttaggtcggcaaactcttgaatctt       c.*1920

          .         . | 12       .         .         .         .    g.26424
 agatgtgtgatgtttcagag | ttaagccttcgaagttttcttcttctaccccacatccatt    c.*1980

          .         .         .         .        | 13.         .    g.28317
 gtctgaaacttcaataagatccactccatagtccttaagctttagat | caatattagtggc    c.*2040

          .         .         .         .         .         .       g.28377
 accagcatccagactgttttctactaactcctttaccgcagtgcttagactcagtaccac       c.*2100

          .         .         .         .         .         .       g.28437
 ctgcccagagcaaatctgatggactgacttccgatcaataggtttgatggccttagcagg       c.*2160

         | 14.         .         .         .         .         .    g.31462
 ttctgta | ctcgagctctcagctcgctccatggatgcaacacccgatccgcctcggggact    c.*2220

          .         .         .         .         .        | 15.      g.31522
 gggaaagttccctccagggctcccacaggcgctccgcctcctgaactcccattggct | c      c.*2278

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The PMS2 postmeiotic segregation increased 2 (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.