proteasome (prosome, macropain) subunit, beta type, 8 (PSMB8) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the PSMB8 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering PSMB8 transcript NM_148919.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.6
 TATTGA                                                             c.6
 Y  X                                                               p.1

          .         .         .         .         .         .       g.66
 caacgcctccagaatagctgtctctgtgagtggcataagcaatagccctgcggccaaggt       c.*60

          .         .         .         .         .         .       g.126
 cataggcctcttcagggctaagattaggccgatagccactgtccatgaccccgtaggcat       c.*120

          .         .         .         .         .         .       g.186
 aagtgttcccactacccgtggagaacatatttcctgagagccgagtcccatgttcatcca       c.*180

          .          | 02        .         .         .         .    g.644
 cgtagtagagtccaggacc | cttcttatcccagccacagatcatactgcccatagagaggc    c.*240

          .         .         .         .         .         .       g.704
 ccatgccccggtactggcacatcatgttggacagcagcttggaggctgccgacactgaaa       c.*300

          .         .          | 03        .         .         .    g.1172
 tacgttctccatttcgcagatagtacagc | ctgcattccttggccagcaggcgctcccagt    c.*360

          .         .         .         .         .         .       g.1232
 actgacagtctgctgcacagccagacatggtgccaagcaggtaagggttaatctcaatca       c.*420

          .         .  | 04      .         .         .         .    g.1450
 ccttgttcacccgtaaggcac | taatgtaggacccagctgaggcccgagaatccactgctg    c.*480

          .         .         .         .         .         .       g.1510
 caatcactccatgctggaacttgaaggcgagcgtggtggtgccatgggccatctcaatct       c.*540

          .         .         .         .          | 05        .    g.2330
 gaacgttcctttctccgtccccacccagggactggaagaattctgtggg | ctgcattcccc    c.*600

          .         .         .         .         .         .       g.2390
 ggggtaaagcgagctctggagatcgcatagagaaactgtagtgtcctgggtccgagcgac       c.*660

          .         .         .         .         .         .       g.2450
 gcccgcttcccgcaaccgggagagccgattccggccgctgccctcggggggctccgcata       c.*720

          .         .         .         .         .          | 06    g.2510
 catctagtagcgccatgaccgcccagcacccagagatctgtccgctctcggaggaggaa | c    c.*780

 

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Proteasome (prosome, macropain) subunit, beta type, 8 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.