ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the RAC2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000022.10, covering RAC2 transcript NM_002872.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.2423
                                                ccctagaggaggc       c.-121

 .         .         .         .         .         .                g.2483
 tgcaggcgcgcttctgctgccgcgtgggctgagggcacagcacggcccggatggcctcgt       c.-61

 .         .         .         .         .         .                g.2543
 cgaacacggttttcaggcctctctgggtgagagctgagcactccaggtatttcaccgagt       c.-1

  | 02       .         .         .                                  g.7030
  | CAATCTCCTTGGCCAGTGCCAGGCCCTGCGGGTAGGTGA                         c.39
  | Q  S  P  W  P  V  P  G  P  A  G  R  X                           p.12

          .         .         .         .         .         .       g.7090
 tgggagccagcttcttctccttcagtttctcgatggtgtccttgtcgtcccgcaggtcca       c.*60

          .         .         .         .         .         .       g.7150
 gcttggtgcccaccaggatgatgggtgtgctggggcagtggtgccgcacttctgggaacc       c.*120

   | 03      .         .         .         .         .         .    g.7751
 a | cttggcgcggacgttctcataagaggctgggctgacgagggagaagcagatgaggaaga    c.*180

      | 04   .         .         .         .         .         .    g.8617
 cgtc | cgtctgtggataggagagcggccggagacggtcgtagtcctcctgcccagcagtgt    c.*240

          .         .         .         .         .         .       g.8677
 cccacagccccaggttcactggcttgctgtccaccatcacattggctgaatagttgtcaa       c.*300

    | 05     .         .         .         .         .         .    g.17405
 ac | acggtggggatgtactctccgggaaaggcgttggtggtgtagctgatgagaaggcagg    c.*360

          .     | 06   .         .         .         .         .    g.19920
 tcttgcccacggcc | ccatctcccaccaccacacacttgatggcctgcatcgtgtccggag    c.*420

          .         .         .         .         .         .       g.19980
 cctggagagtgtcggtggtgacagctcagggccaggcgcgtttctgcgggcgcaaggggt       c.*480

          .         .         .         .         .         .       g.20040
 gtggaggctggtgaggcgcctgctgaggagcagcggtggtggggcaggaggaaacggaag       c.*540

          .         . | 07       .         .         .         .                                           g.20100
 gggaacttactcaagctgct | t                                           c.*561

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.