RNA component of mitochondrial RNA processing endoribonuclease (RMRP) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the RMRP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000009.11, covering RMRP transcript NM_174923.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.1569
                               ctgctcgcgtgcgcgtgcgcgttggggcgg       c.-61

 .         .         .         .         .         .                g.1629
 ccggccaatgccggaccgcttcggcaccgcccgcccgatccctccacccgtgggccggca       c.-1

          .         .         .         .         .         .       g.1689
 ATGGCGGGCGCAGTTTCGCTCTTGGGTGTGGTGGGGCTGCTGCTTGTGTCTGCGCTGTCC       c.60
 M  A  G  A  V  S  L  L  G  V  V  G  L  L  L  V  S  A  L  S         p.20

          .         .         .         .       | 02 .         .    g.1839
 GGGGTCCTAGGAGACCGCGCCAATCCCGACCTCCGGGCACACCCAG | GGAACGCAGCCCAC    c.120
 G  V  L  G  D  R  A  N  P  D  L  R  A  H  P  G |   N  A  A  H      p.40

          .         .         .         .         .         .       g.1899
 CCCGGCTCTGGAGCCACGGAACCCCGGCGGCGACCACCGCTCAAGGATCAACGCGAGCGG       c.180
 P  G  S  G  A  T  E  P  R  R  R  P  P  L  K  D  Q  R  E  R         p.60

          .         .         .         .         .         .       g.1959
 ACCCGGGCCGGGTCGCTGCCTCTGGGGGCGCTGTACACCGCGGCCGTCGCGGCTTTTGTG       c.240
 T  R  A  G  S  L  P  L  G  A  L  Y  T  A  A  V  A  A  F  V         p.80

          .                                                         g.1977
 CTGTACAAGTGTTTGCAG                                                 c.258
 L  Y  K  C  L  Q  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?         p.86

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The RNA component of mitochondrial RNA processing endoribonuclease protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.