ring finger protein 168, E3 ubiquitin protein ligase (RNF168) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the RNF168 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000003.11, covering RNF168 transcript NM_152617.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .                           g.48
 CTTAGATACGGAGTCTTTCCTGACTTCTTGTACAGCTTCAGAGTGTGA                   c.48
 L  R  Y  G  V  F  P  D  F  L  Y  S  F  R  V  X                     p.15

          .         .         .     | 02   .         .         .    g.8565
 ggctgacccaaactgagatttcggtgtcaaatac | ttctgaatatctccagtgtttctttg    c.*60

          .         .         .         .         .         .       g.8625
 tttgttcttacttttcttttcagacttgggtgtaactggatcagattttctggaattcaa       c.*120

          .         .         .       | 03 .         .         .    g.12192
 gggagaagccgagatacttccctcacagaaattgtt | aatatcaatgcttagctttcttgc    c.*180

          .         .         .         .         .         .       g.12252
 cagttcctcatcacttttcagttgttcttccatcgctcttcgccttttttctgcctgtct       c.*240

          .         .         .         .         .         .       g.12312
 tttttcctcttcttcctcctctgccaacaacctctgtatgtattcttcactggctttgtt       c.*300

          .         .         .       | 04 .         .         .    g.13400
 ttcttcttcctcgctggcccgtcgctctgccgccac | cttgcttatttcctcttcatattc    c.*360

          .         .         .         .         .    | 05    .    g.27649
 tcttctcagttccccaggtttactgagcagacgaactggctgatagtcatcag | ccacttc    c.*420

          .         .         .         .         .         .       g.27709
 ctctgattcttggccagacgctctaagcttgcactccctgggatagtgtttttgaattat       c.*480

          .         .         .         .         .         .       g.27769
 cgtccacagttccacgttgacgagagaatttcttcgggtatggtaccgagtccacgacga       c.*540

          .         .         .         .         .         .       g.27829
 tacccggcggcgacagaagggacagcataaactcgccttttcgacggtcgactggaagca       c.*600

          .         .         .         .         .         .       g.27889
 cggtttacacagcgtgtggttacacgggagggtgacgggctccacgaggatttccatgca       c.*660

          .         .         .         .         .         .       g.27949
 gatcccgcactggcactcggacagcgaggggatggcgtctttgggtagagccatttcaat       c.*720

          .         .         .         .         .         .       g.28009
 atgttagtaaagccgactaaacaacgacacctgcacgaaaaagaatcctattttcggcca       c.*780

          .         .         .         .         .         .       g.28069
 accacagagagagcaaaagcagttttgtgtttcagtattatgcccagaagcgtatcagaa       c.*840

          .         .         .         .         .         .       g.28129
 ttcggagaacaggagcatccaacacgtcttgaagcaaaaaggcgctctcagggtcaggca       c.*900

          .         .         .         .         .         .       g.28189
 aacaggaataccccggagggcggcgtctttgtccattttcaaggcaaacgtcccgccagc       c.*960

          .         .         .         .         .         .       g.28249
 aaataaatgcaggttttcgtcggaggagcctggctgctccgcggcatgaacaccgcggct       c.*1020

          .         .         .         .         .         .       g.28309
 gcggctcccggggcagcgaggggaacgcgccaagtcctctcctcccctcacccggaaagg       c.*1080

          .         .         .         .         .         .       g.28369
 atgctccgctcagctcggggcagccgggccccgggacgcggctccgggaggaagcccggg       c.*1140

          .         .         .         .         .         .       g.28429
 ctccggctgcagcataacttccgctttaccgctgctgcgggggagacgcgcgactcccgt       c.*1200

          .         .         .         .         .         .       g.28489
 gttcacctttcgggcgcctggcgcagtttcccagagctccgcgcccccgtccctcctacg       c.*1260

          .         .         .         .          | 06        .              g.28549
 cagccagaaaccctattcgttgcggcagcgcagcagccaccggacaagc | t              c.*1310

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ring finger protein 168, E3 ubiquitin protein ligase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.