ribosomal protein L35a (RPL35A) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the RPL35A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000003.11, covering RPL35A transcript NM_000996.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.1013
                                                ggcctcgtccttc       c.-61

 .         .         .        | 02.         .         .             g.1787
 tcttaccgccatcttggctcctgtggag | gcctgctgggaacgggacttctaaaaggaact    c.-1

          .  | 03      .         .         .         .         .    g.2027
 ATGTCTGGAAG | GCTGTGGTCCAAGGCCATTTTTGCTGGCTATAAGCGGGGTCTCCGGAAC    c.60
 M  S  G  R  |  L  W  S  K  A  I  F  A  G  Y  K  R  G  L  R  N      p.20

          .         .         .         .         .         .       g.2087
 CAAAGGGAGCACACAGCTCTTCTTAAAATTGAAGGTGTTTACGCCCGAGATGAAACAGAA       c.120
 Q  R  E  H  T  A  L  L  K  I  E  G  V  Y  A  R  D  E  T  E         p.40

          .         .         .         .     | 04   .         .    g.4838
 TTCTATTTGGGCAAGAGATGCGCTTATGTATATAAAGCAAAGAA | CAACACAGTCACTCCT    c.180
 F  Y  L  G  K  R  C  A  Y  V  Y  K  A  K  N  |  N  T  V  T  P      p.60

          .         .         .         .         .         .       g.4898
 GGCGGCAAACCAAACAAAACCAGAGTCATCTGGGGAAAAGTAACTCGGGCCCATGGAAAC       c.240
 G  G  K  P  N  K  T  R  V  I  W  G  K  V  T  R  A  H  G  N         p.80

          .         .         .         .         .         .       g.4958
 AGTGGCATGGTTCGTGCCAAATTCCGAAGCAATCTTCCTGCTAAGGCCATTGGACACAGA       c.300
 S  G  M  V  R  A  K  F  R  S  N  L  P  A  K  A  I  G  H  R         p.100

           | 05        .         .                                  g.6620
 ATCCGAGTG | ATGCTGTACCCCTCAAGGATTTAA                               c.333
 I  R  V   | M  L  Y  P  S  R  I  X                                 p.110

          .         .         .         .         .         .       g.6680
 actaacgaaaaatcaataaataaatgtggatttgtgctcttgtatttttaagtggattaa       c.*60

          .                                                         g.6698
 aaaacttactaccttaaa                                                 c.*78

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein L35a protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.