ribosomal protein S17 (RPS17) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the RPS17 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000015.9, covering RPS17 transcript NM_001021.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CAAAAGCTTCAGCATTTCCTTAGTGTCAGGATCTACTTCAATAATCTCCTGATCCAAGGC       c.60
 Q  K  L  Q  H  F  L  S  V  R  I  Y  F  N  N  L  L  I  Q  G         p.20

                                                                g.63
 TGA |                                                             c.64
 X                                                               p.20

     | 02    .         .         .         .         .         .    g.631
 gac | ctcaggaacataattgtctctcctttctctctcctcctcctgcagcttgatggagat    c.*60

          .         .         .         .          | 03        .    g.1686
 acctcttactgggcctctctgaattcgcttcatcagatgcgtgacataa | cctgctatctt    c.*120

          .         .         .         .         .         .       g.1746
 gttgcggagctttttgctggggataatggcgatctcctcgcacacgcgcttgttcgtgtg       c.*180

          .         .         .         .         .         .       g.1806
 gaagtcgttgcccaggcgcgtgtagtacttttctatgatgacccgggccgccttcttcac       c.*240

          .         .  | 04      .         .         .    | 05    .       g.2159
 ggttttggtgcgaacgcggcc | catgttggcgggtccttggtaaaagaggaaac | c       c.*294

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein S17 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.