ribosomal protein S19 (RPS19) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the RPS19 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering RPS19 transcript NM_001022.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.1012
                                                 gtactttcgcca       c.-361

 .         .         .         .         .         .                g.1072
 tcatagtattctccaccactgttccttccagccacgaacgacgcaaacgaagccaagttc       c.-301

 .         .         .         .         .         .                g.1132
 ccccagctccgaacaggagctctctatcctctctctattacactccgggagaaggaaacg       c.-241

 .         .         .         .         .         .                g.1192
 cgggaggaaacccaggcctccacgcgcgaccccttggccctcccctttacctctccaccc       c.-181

 .         .         .         .         .         .                g.1252
 ctcactagacaccctcccctctaggcggggacgaactttcgccctgagagaggcggagcc       c.-121

 .         .         .         .         .         .                g.1312
 tcagcgtctaccctcgctctcgcgagctttcggaactctcgcgagaccctacgcccgact       c.-61

 .         .         .         .         .         .                g.1372
 tgtgcgcccgggaaaccccgtcgttccctttcccctggctggcagcgcggaggccgcacg       c.-1

  | 02       .         .         .         .         .         .    g.1917
  | ATGCCTGGAGTTACTGTAAAAGACGTGAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCC    c.60
  | M  P  G  V  T  V  K  D  V  N  Q  Q  E  F  V  R  A  L  A  A      p.20

          .  | 03      .         .         .         .         .    g.2242
 TTCCTCAAAAA | GTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGATACCGTCAAGCTGGCC    c.120
 F  L  K  K  |  S  G  K  L  K  V  P  E  W  V  D  T  V  K  L  A      p.40

          .         .         .         .         .   | 04     .    g.10121
 AAGCACAAAGAGCTTGCTCCCTACGATGAGAACTGGTTCTACACGCGAGCTG | CTTCCACA    c.180
 K  H  K  E  L  A  P  Y  D  E  N  W  F  Y  T  R  A  A |   S  T      p.60

          .         .         .         .         .         .       g.10181
 GCGCGGCACCTGTACCTCCGGGGTGGCGCTGGGGTTGGCTCCATGACCAAGATCTATGGG       c.240
 A  R  H  L  Y  L  R  G  G  A  G  V  G  S  M  T  K  I  Y  G         p.80

          .         .         .         .         .         .       g.10241
 GGACGTCAGAGAAACGGCGTCATGCCCAGCCACTTCAGCCGAGGCTCCAAGAGTGTGGCC       c.300
 G  R  Q  R  N  G  V  M  P  S  H  F  S  R  G  S  K  S  V  A         p.100

          .         .         .         .         .       | 05 .    g.10785
 CGCCGGGTCCTCCAAGCCCTGGAGGGGCTGAAAATGGTGGAAAAGGACCAAGATGG | CGGC    c.360
 R  R  V  L  Q  A  L  E  G  L  K  M  V  E  K  D  Q  D  G  |  G      p.120

          .         .         .         .         .  | 06      .    g.12440
 CGCAAACTGACACCTCAGGGACAAAGAGATCTGGACAGAATCGCCGGACAG | GTGGCAGCT    c.420
 R  K  L  T  P  Q  G  Q  R  D  L  D  R  I  A  G  Q   | V  A  A      p.140

          .                                                         g.12458
 GCCAACAAGAAGCATTAG                                                 c.438
 A  N  K  K  H  X                                                   p.145

          .         .         .                                     g.12497
 aacaaaccatgctgggttaataaattgcctcattcgtaa                            c.*39

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein S19 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.