ribosomal protein S24 (RPS24) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the RPS24 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering RPS24 transcript NM_033022.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.1022
                                       aggcatcggcgcggtcagcctc       c.-121

 .         .         .         .         .         .                g.1082
 gtggcgcgcccacgcccccacgccggctcttcccggggtccttccgtgcgcgttgatatg       c.-61

 .         .         .         .         .         .                g.1142
 attggccggcgaatcgtggttctcttttcctccttggctgtctgaagatagatcgccatc       c.-1

     | 02    .         .         .         .         .         .    g.2649
 ATG | AACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAACCGACTACTTCAGAGG    c.60
 M   | N  D  T  V  T  I  R  T  R  K  F  M  T  N  R  L  L  Q  R      p.20

           | 03        .         .         .         .         .    g.2802
 AAACAAATG | GTCATTGATGTCCTTCACCCCGGGAAGGCGACAGTGCCTAAGACAGAAATT    c.120
 K  Q  M   | V  I  D  V  L  H  P  G  K  A  T  V  P  K  T  E  I      p.40

          .         .         .         .         .         .       g.2862
 CGGGAAAAACTAGCCAAAATGTACAAGACCACACCGGATGTCATCTTTGTATTTGGATTC       c.180
 R  E  K  L  A  K  M  Y  K  T  T  P  D  V  I  F  V  F  G  F         p.60

          .         .         .         .         .         .       g.2922
 AGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTCCCTGGAT       c.240
 R  T  H  F  G  G  G  K  T  T  G  F  G  M  I  Y  D  S  L  D         p.80

          .         .         .          | 04        .         .    g.4455
 TATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGA | CATGGCCTGTATGAGAAGAAA    c.300
 Y  A  K  K  N  E  P  K  H  R  L  A  R   | H  G  L  Y  E  K  K      p.100

          .         .         .         .         .         .       g.4515
 AAGACCTCAAGAAAGCAACGAAAGGAACGCAAGAACAGAATGAAGAAAGTCAGGGGGACT       c.360
 K  T  S  R  K  Q  R  K  E  R  K  N  R  M  K  K  V  R  G  T         p.120

          .         .         . | 05                            g.7474
 GCAAAGGCCAATGTTGGTGCTGGCAAAAAG | TGA |                            c.394
 A  K  A  N  V  G  A  G  K  K   | X                              p.130

          .          | 06        .         .         .         .    g.7923
 gctggagattggatcacag | ccgaaggagtaaaggtgctgcaatgatgttagctgtggcca    c.*60

          .         .         .         .         .         .       g.7983
 ctgtggatttttcgcaagaacattaataaactaaaaacttcatgtgtctggttgtttgaa       c.*120

                                                                    g.7984
 a                                                                  c.*121

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein S24 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.