ribosomal protein S26 (RPS26) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the RPS26 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering RPS26 transcript NM_001029.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.1025
                                    ggagacacataacctcgattttctt       c.-241

 .         .         .         .         .         .                g.1085
 ccgccatccggctaaatagtcccatgtgcactttgttccatggataaataaacactagga       c.-181

 .         .         .         .         .         .                g.1145
 acgcatttccaccctagatttcagcagaaatgctgaatgtaaaggaatatttgagtaaag       c.-121

 .         .         .         .         .         .                g.1205
 tgagttgccgttcttgaagcccgtctcctaaggattctcccggtgtccgcgtagggatct       c.-61

 .         .         .         .         .         .                g.1265
 catgctatataggagggccctgccaggcaccgtctcctctctccggtccgtgcctccaag       c.-1

     | 02    .         .         .         .         .         .    g.1580
 ATG | ACAAAGAAAAGAAGGAACAATGGTCGTGCCAAAAAGGGCCGCGGCCACGTGCAGCCT    c.60
 M   | T  K  K  R  R  N  N  G  R  A  K  K  G  R  G  H  V  Q  P      p.20

          .         .         .         .         .         .       g.1640
 ATTCGCTGCACTAACTGTGCCCGATGCGTGCCCAAGGACAAGGCCATTAAGAAATTCGTC       c.120
 I  R  C  T  N  C  A  R  C  V  P  K  D  K  A  I  K  K  F  V         p.40

          .         .         .         .         .         .       g.1700
 ATTCGAAACATAGTGGAGGCCGCAGCAGTCAGGGACATTTCTGAAGCGAGCGTCTTCGAT       c.180
 I  R  N  I  V  E  A  A  A  V  R  D  I  S  E  A  S  V  F  D         p.60

   | 03      .         .         .         .         .         .    g.2520
 G | CCTATGTGCTTCCCAAGCTGTATGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCAC    c.240
 A |   Y  V  L  P  K  L  Y  V  K  L  H  Y  C  V  S  C  A  I  H      p.80

          .         .         .         .         .         .       g.2580
 AGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACACCCCCACCCCGA       c.300
 S  K  V  V  R  N  R  S  R  E  A  R  K  D  R  T  P  P  P  R         p.100

          .   | 04     .         .         .                        g.3265
 TTTAGACCTGCG | GGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAA                c.348
 F  R  P  A   | G  A  A  P  R  P  P  P  K  P  M  X                  p.115

          .         .         .         .         .         .       g.3325
 ggagctgagttcttaaagactgaagacaggctattctctggagaaaaataaaatggaaat       c.*60

                                                                    g.3334
 tgtacttaa                                                          c.*69

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein S26 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.