(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.1482
gtgagagggtttccctggggtctggggtggggggaggcgccccgcccgggaggggaggcg c.75+60
g.1488
gccgcg c.75+66
--------------------- middle of intron ---------------------
g.1489 g.1494
c.76-66 cgtgtg c.76-61
. . . . . . g.1554
ttgggcccggggtgctcggacgcgcgctcagggtcggtcctgctgttcgttgcttcttag c.76-1
Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center