(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.4747
gtgaccctagttcccaggcctctcctggcctcctgtggggatggttggcaagggatggcg c.301+60
. . . . . . g.4807
ctgagggtggggtgggcccatggggactcctgccgtctctcaagcagaactcaaggagaa c.301+120
. . . . . g.4864
ttttttagctgctgtataatttctcgccatcgtgggtgtaaacctagggttgggctt c.301+177
--------------------- middle of intron ---------------------
. . . . . g.4920
ttttgctgaattagggcacggcagatgcccacttcacccatttttgataaaccagt c.302-121
. . . . . . g.4980
atctggggtgtcagattcttggctgtctgcagggccgagttagccgaatgccacctgcct c.302-61
. . . . . . g.5040
ttgatacgtgagaacgttgtctgagaaccgtgacttctgtgcttgcttgtgtctggtcag c.302-1
Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center