regulator of telomere elongation helicase 1 (RTEL1) - 363 nt intron 26 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.33692
gtgcggacgggcagcgctgggtgggcggtgtgggggtggcggagcgggcggcgtggggcg  c.2485+60

         .         .         .         .         .         .  g.33752
ggcagcaccaggcgcccagggcggaggcgactcacctggctttgtgcgcttcccctccca  c.2485+120

         .         .         .         .         .         .  g.33812
cctccaaaggctgcctctccctcctagggcagggcccccacgggctgcaaccctccccta  c.2485+180

    g.33814
ca  c.2485+182

--------------------- middle of intron ---------------------
                                               g.33815        g.33815
                                               c.2486-181  g  c.2486-181

.         .         .         .         .         .           g.33875
gcagagaacgccccaggcaaggatgccccccgaggctgagactccccccaatagcaggga  c.2486-121

.         .         .         .         .         .           g.33935
ggacacccacaggcaggaccccaagtgctgggactctcccccaagaggggctttgccaca  c.2486-61

.         .         .         .         .         .           g.33995
ggcagggaccccagctggggccccccgtgggcttcactgcgcactcgggtgcccctgcag  c.2486-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center