regulator of telomere elongation helicase 1 (RTEL1) - 794 nt intron 27 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.34198
gtacagttccagggccttgggatggacacagaccctctgtctcctgaggccaacccgacc  c.2628+60

         .         .         .         .         .         .  g.34258
ccgcccatctggcctcaggcacctccccacacacccctgtaaatcccctgcctggcaggc  c.2628+120

         .         .         .         .         .         .  g.34318
aggcgggcaagcgggcgggggatcccagctgcctggctgtctgtgggtcctccaccccac  c.2628+180

         .         .         .         .         .         .  g.34378
ctcacccacaggctgctggctcccaggtggtgcatgccctggccctccgcgggtgccccc  c.2628+240

         .         .         .         .         .         .  g.34438
cacatcactttggttctctggcgggtcagcttggctcagtgcactcaaggtcgggtgccc  c.2628+300

         .         .         .         .         .         .  g.34498
ctgccactggctgcgcttgaggctggcctttctccaggaatgtgctgcgggtggaaccca  c.2628+360

         .         .         .         g.34535
ggttccttcttccttggggccttttgccccagaagcc  c.2628+397

--------------------- middle of intron ---------------------
           g.34536            .         .         .           g.34572
           c.2629-397  cataattcctcaggccaacccgaaattttctccctgc  c.2629-361

.         .         .         .         .         .           g.34632
ttcctgctgggagccattcccctcttcctgcccatccctgcccttcaggcccctggagtg  c.2629-301

.         .         .         .         .         .           g.34692
agctccaggtgcaggcaccaggcacctgtgtccccttcctgccagcccctcgctgtggtc  c.2629-241

.         .         .         .         .         .           g.34752
ggactgtcttccctggacctgctcttacaagtcaccacctgcgagcctcatgagccgctg  c.2629-181

.         .         .         .         .         .           g.34812
gtgtgacttggacaggaccaagttgtggcactgtcaccggggtgtgctgtgcccccctcc  c.2629-121

.         .         .         .         .         .           g.34872
cccgacctccatcttggctcagggctccttgggaccatcttccctgtgcgtccaggtgct  c.2629-61

.         .         .         .         .         .           g.34932
ttgggaccccagagtgtgtggttggggtctgtgtgtggttgtgagctgtgtcctcctcag  c.2629-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center