regulator of telomere elongation helicase 1 (RTEL1) - 967 nt intron 28 reference sequence

(intronic numbering for coding DNA Reference Sequence)
         .         .         .         .         .         .  g.35088
gtgcgtgagctgtccctgcacctgtgccgaccaccatagacacgcatgggaacgcagccg  c.2724+60

         .         .         .         .         .         .  g.35148
tgggtgcccccagccacggctggtcccgatgggaccagggaatccacccccaggagctga  c.2724+120

         .         .         .         .         .         .  g.35208
tgtccagggcagctgtgatgctgacggccaggggctcaagtgtgtggtttcttctgcagg  c.2724+180

         .         .         .         .         .         .  g.35268
gggctcatgagtcccagctggaatcaggccccacccttgggcaggtttggcatggggcct  c.2724+240

         .         .         .         .         .         .  g.35328
gcagcactgggcttggccctggcatttccctcaagtgtggatgcacacctgcctcatgtg  c.2724+300

         .         .         .         .         .         .  g.35388
agggacacagcccattcctagccttggatcaaagaacggagttatagccggagccaggaa  c.2724+360

         .         .         .         .         .         .  g.35448
gccccctgcctgctggaaaaccccaagtgtggcggcctttgtccatgtcccttggcttct  c.2724+420

         .         .         .         .         .         .  g.35508
gggaagaactgggtggtgcccaggcagggctggtgccatcaggaagtgggtggctgctga  c.2724+480

      g.35512
gggg  c.2724+484

--------------------- middle of intron ---------------------
                                             g.35513          g.35515
                                             c.2725-483  cct  c.2725-481

.         .         .         .         .         .           g.35575
gggctggcgagggcctgggtggggagtgcctgggccgcccctgccttggtttccacgttt  c.2725-421

.         .         .         .         .         .           g.35635
ccgtgttggtctggggtgtgtagagagatgggcactgctcatccggaagcccctccttgt  c.2725-361

.         .         .         .         .         .           g.35695
gcgctgccatcctgggagcctcagccgcatccgctgtggggcagggggcttgagggagga  c.2725-301

.         .         .         .         .         .           g.35755
ggagagagacgggccatgcaggacccctggcttgaggcagagccaatctaccctttgccc  c.2725-241

.         .         .         .         .         .           g.35815
attcactgctctcagttccctgccagcctctcactgtgtgacctcagacgggcccagccc  c.2725-181

.         .         .         .         .         .           g.35875
cacagctttcttcccgcagcccctccctatgtccatccagccagccagtttctcaggcag  c.2725-121

.         .         .         .         .         .           g.35935
cagccccacctcggcagtcactgtcccagggaacgctcaatgttccaaggaaggctctgc  c.2725-61

.         .         .         .         .         .           g.35995
agccccagggaccagatgatgaggctggccctgatggagcctcgggcctgtgtcctgcag  c.2725-1