regulator of telomere elongation helicase 1 (RTEL1) - 252 nt intron 31 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.37739
gtagctgactcctgaaccgtgtgcagcctacgacttggtgggtccctcagtggcttcacg  c.3181+60

         .         .         .         .         .         .  g.37799
aggctaactcttgagtgtggccggggctgcccctgtggggagccatctcatggtggggac  c.3181+120

        g.37805
tgctcc  c.3181+126

--------------------- middle of intron ---------------------
                                          g.37806             g.37811
                                          c.3182-126  cggttc  c.3182-121

.         .         .         .         .         .           g.37871
tgcaccccgcagttgtcctgagcagctctccaggagttcctggaggaagggcgggcaggg  c.3182-61

.         .         .         .         .         .           g.37931
cggtgggactctcagtcctccaccccagcgccactctgagccatgctactcccacaccag  c.3182-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center