regulator of telomere elongation helicase 1 (RTEL1) - 297 nt intron 34 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.38731
gtgagcctcatgggagagacatcgctgggcagcaggccacgggagctccgggcgggcccc  c.3724+60

         .         .         .         .         .         .  g.38791
tctcagcaggctgtgtgtgccagggctgtggggcagaggacgtggtgcccttccagtgcc  c.3724+120

         .         .           g.38820
ctgcctgtgacttccagcgctgccaagcc  c.3724+149

--------------------- middle of intron ---------------------
                    g.38821             .         .           g.38848
                    c.3725-148  tgctggcaacggcaccttcaggttggtg  c.3725-121

.         .         .         .         .         .           g.38908
cctggccactacagttcctgctgggtgtagccccaggtgatgggctgagggggaaagggc  c.3725-61

.         .         .         .         .         .           g.38968
aggcccttgtcctggtggcaacgcctggcagacgtgtgcagtgggccggttgtctcacag  c.3725-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center