Shwachman-Bodian-Diamond syndrome (SBDS) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the SBDS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering SBDS transcript NM_016038.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.9
 GATTTCTAA                                                          c.9
 D  F  X                                                            p.2

          .         .         .         .         .         .       g.69
 ctgttggccataatcttcactttctatgaccttgatcagtggcttgagcttttctttcag       c.*60

          .         .         .         .         .         .       g.129
 cttcttgccttcattgactggaaggatgaaccgaagcctcatgtgagcacgttctatctt       c.*120

          .         .         .       | 02 .         .         .    g.2104
 cattttctcttttaactgctttatcacttccaaagc | ctgctgttttgtactcttgttggt    c.*180

          .         .         .         .         .         .       g.2164
 tttcaccgaatagtggatgtccttcatggctctctcaataaggatcacggtgtatggtct       c.*240

          .         .         .         .         .         .       g.2224
 ctttgtttcaggattcacacatttgtctgccacaatagttgcaatgtccctaaacatctg       c.*300

          .         .         .         .         .        | 03.    g.3078
 ctccagttgtgtgtgtctttctttatctgatacttgaacttctcctttagtcaaaat | ctg    c.*360

          .         .         .         .         .         .       g.3138
 cttacagatttcagtttggtcatctgttccaaacgcactgatgagatcttcctttttggc       c.*420

          .         .         .         .         .         .       g.3198
 aacctgacctttagaaacatttacaaacactgagtgggtctgcagaacttcatcgaggtc       c.*480

         | 04.         .         .         .         .         .    g.4206
 tttttcc | acgccgctccgccagccgacgaccttgtttttgtagcaggcgatttcgaagcg    c.*540

          .         .         .         .         .         .       g.4266
 cttcccggcacgcttcatccgtaccacggccacattggttaggcggatctggttggtggg       c.*600

          .         .         .         .         .         .       g.4326
 ggtgaagatcgacatcgcggctgttcaaagacccagaagccggcgaaccagggctgaccc       c.*660

          .         .         .         .         .         .       g.4386
 gcgccgtccagcctgaaggccaccagcgcctcgcggtaacgaccgatcggcgcgcggcac       c.*720

          .         .         .         .         .         .       g.4446
 tgacccaaccaccagtgcgcggcgccgcgactcactagcttcaggcagccgtcacagtgt       c.*780

          .          | 05        .         .         .         .                                            g.4506
 gtctggcaggcttacttac | c                                            c.*800

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Shwachman-Bodian-Diamond syndrome protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.