solute carrier family 37 (glucose-6-phosphate transporter), member 4 (SLC37A4) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the SLC37A4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering SLC37A4 transcript NM_001164277.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .                                                         g.12
 CATTGGCCATGA                                                       c.12
 H  W  P  X                                                         p.3

          .         .         .         .         .         .       g.72
 gtcccacaatggcgtgggaggtgccacacaagttgggaggggcactctcgttggctatga       c.*60

          .         .         .         .         .         .       g.132
 ctccaaacagggcaatggggccatacgaggagaaaccaaatacagctcccaataccagga       c.*120

         | 02.         .         .         .         .         .    g.829
 tccagag | cttgggggagtcactggtcactgttacccggaagaggtacatggacactgtca    c.*180

          .         .         .         .         .         .       g.889
 tgccagccatcatgaacagcaacaggccatggcgagggttcccgtagttggacagtcccg       c.*240

   | 03      .         .         .         .         .         .    g.1471
 c | ctttgccatggcccggtctgacaggtagccagctgcgatgctgcctacaaggcccccaa    c.*300

          .         .        | 04.         .         .         .    g.1779
 cttccagggcactcatgtaggagctac | ctacaagggctgactgtcctttctcctggataa    c.*360

          .         .         .         .         .         .       g.1839
 ggaagaactggccccagtcagtacagcaggtctttactccaaacaccacaaggtaaccag       c.*420

          .         .         .         .         .         .       g.1899
 tggagagcacccacaggtaaggggacagcagcagctcctgcagggtgctctcctccttca       c.*480

        | 05 .         .         .         .         .         .    g.2491
 aggagc | ccttcttgccctcagagggcatggggtccaggttgcggagtccaacatcagcag    c.*540

          .         .         .         .         .         .       g.2551
 gttcattgtggatgagcaggagacagaggaaggagacaaccacaccacagtgccccagat       c.*600

          .         .         .         .         .         .       g.2611
 agggccagcgtgctgcgccagctgtagctctgggcaaggatggttgccaggatagggccc       c.*660

          .         .         .         .         .         .       g.2671
 agccctccagccaggttcatgctggttgacaggatggcccaccaagtgccaaactgagat       c.*720

          .  | 06      .         .         .         .         .    g.3052
 ggctcaaacca | cttccgcaggaccttcccacatgggggccagcccagcccctgggccagg    c.*780

          .         .         .         .         .         .       g.3112
 ccattaaggaaccagagggcagcaaagacaggtactgtggagctccaggcaaagaatatg       c.*840

          .         .         .         .         .         .       g.3172
 ttgaccaggccaaccaggagcagcccagaagagaagagccagcgagcactcatctggtca       c.*900

          .         .         .         .         .         .       g.3232
 gacagcaccccactgacaaacttgctgatagcataagctgccgactggctgctggtgatg       c.*960

      | 07   .         .         .         .         .         .    g.4087
 aacc | ccaaatcatccttgtccaaagggatctcttccaccaatgatggcatgacaaaggag    c.*1020

          .         .         .         .         .         .       g.4147
 aaggtcttgcgattgaagtaatacaggctgtagcccccaaacatggctgagaagatcaca       c.*1080

          .         .         .         .         .         .       g.4207
 gtgcgataatagccatagccctgggctgccatggtagaaaagagcaggccctaccagcca       c.*1140

          .         .         .         .         .         .       g.4267
 agacgcacagcctctgaccacagttcctgcttgccgctctcacagttcccagatctgctg       c.*1200

          .         .         .         .         .         .       g.4327
 agttgggttttttctgctccctcctccacccagcctcccaggctccctttatagccgcct       c.*1260

          .         .         .         .        | 08.         .    g.5054
 tctggacaatcattaagcctggggaggctccaaggggacccagtgtc | ctgtgggacgttg    c.*1320

          .         .         .         .         .         .       g.5114
 gcaggggccgcaagcagagggactgggcagctcgtgggcgggaaggtgccccggcgggct       c.*1380

          .         .         .         .         .         .       g.5174
 tcgggctgcagggcacaaccgtcccgcccagggccccggcaacatgccccggcttttccg       c.*1440

          .         .         .         .         .         .       g.5234
 ctcaattgggaaagcaactggagcagaaggcgtaggcgcacgcggagcgggcgaccgcac       c.*1500

          .         .         .         .         .         .       g.5294
 gtattctcccggaggccccgcgcttctggcacccagaggctcagcctggtaggggagggc       c.*1560

          .         .         .         .         .         .       g.5354
 caggcggcgggcgggagaggaggagaggcggcgggcggcgaagaggcggcgggctcgtgg       c.*1620

          .         .         .         .         .         .       g.5414
 cacctgcccagccccgtgggtcctcacgctacccaggacacgctactgtgcggctgggaa       c.*1680

          .         .         .         .         .         .       g.5474
 ccacgggggccgggggtgcaggagctggagaggtgcggagaccacaggactggcgcgata       c.*1740

          .         .         .         .         .         .       g.5534
 gaaaggggtctcgtgctggtggtcagggacagcgcctcggtggccccaagacccatgaat       c.*1800

          .  | 09      .         .         .         .         .    g.5707
 tgtctctggaa | ctgaacagaggcgggagcccgaataggacggggcggggctagcgaaggc    c.*1860

           | 10        .         .         .         .         .                                                      g.5767
 tgcgcaagc | a                                                      c.*1870

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Solute carrier family 37 (glucose-6-phosphate transporter), member 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.