solute carrier family 7 (amino acid transporter light chain, y+L system), member 7 (SLC7A7) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the SLC7A7 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000014.8, covering SLC7A7 transcript NM_001126106.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .                           g.48
 CCACGATCCTTCGGAGGTAAAGCGGTCGCTTATGTTCTGGCACTCTGA                   c.48
 P  R  S  F  G  G  K  A  V  A  Y  V  L  A  L  X                     p.15

          .         .         .         .         .         .       g.108
 tgatgaggaagtaaaagggcaggcctgagagggcaatggcaatgccgatgagggagttga       c.*60

          .         .         .         .         .         .       g.168
 tagtatcactgtaaagtggaacagccaccaggaagatggtgcagaggcagaagacaatcg       c.*120

          .       | 02 .         .         .         .         .    g.465
 ggaagaaaacgctgag | cttgaggggacgaggtcgatcaggctccttccagcgcagataaa    c.*180

          .         .         .         .         .         .       g.525
 gctgacccacaatagaaagccccacaaagaaccagtagctgaagctgtagtagttaatga       c.*240

          .         .         .         .       | 03 .         .    g.1525
 gctggaagatgtcttccacgcacaagtagatcaatgccatgatacc | attgaagagcagag    c.*300

          .         .         .         .         .         .       g.1585
 aaggcactggtgtgaaccgctcaacatggatcatgcagatggcatcagggagatggcctt       c.*360

          .         .    | 04    .         .         .         .    g.1937
 ctcttgagcccacaaagaaaagc | ctagaagcagccacaatggaggcattgaggccaccaa    c.*420

          .         .         .         .         .         .       g.1997
 aacaggataatgcaactgacagtggaattatccagttaaatattccaaatatctgatctg       c.*480

         | 05.         .         .         .         .         .    g.2315
 caaaagt | cacagcaacagcatcactggccaagatgtctctcatgtctagcacagtataat    c.*540

          .         .         .         .         .         .       g.2375
 aggccacattggtcaagatatagatgatggtgacaatgggcatggagatgccaatggaga       c.*600

          .  | 06      .         .         .         .         .    g.4909
 ggggcaggttc | ctctcaggattcttgatctcttcagtgacatagttgagggtgtcccagc    c.*660

          .         .         .         .         .         .       g.4969
 ctgagtaggagaacagagctgagtacagtgccagggcaatgtcacccactgcaaatgatg       c.*720

          .         .         .       | 07 .         .         .    g.6017
 aaccctcaaaggaattctcaaaatgagtagaggctc | cctggccaagtctaacaatgcctg    c.*780

          .         .         .         .         .         .       g.6077
 caacgatgaccgcgatcagtgccaatactttagcataggtgaaaatatcttgtaccaggg       c.*840

          .         .         .         .   | 08     .         .    g.38985
 ttccccatttgacataggcacagttaatgaaggttaagagac | aaatgcaggcagcagcca    c.*900

          .         .         .         .         .         .       g.39045
 gcaggcggctggcagcataaggggcgaagcagctcgggaagagaggctgtaccatgtagt       c.*960

          .         .         .         .         .         .       g.39105
 tggcaaaggtgatggcaatgatggcctggctggtgggctcaatgatgagcagggaggtcc       c.*1020

          .         .         .         .         .         .       g.39165
 agagtctgatgaaagcaaggaatcctccaaaggcctccaggatataggcatagctggccc       c.*1080

          .         .         .         .         .         .       g.39225
 cagatttcttaatggtggtgcccagttccgcataacaaagggccccaaagacggagaaga       c.*1140

          .         .         .         .         .         .       g.39285
 ggcccccgacagcccagatgaccagagagagaccaaaggaggcactgtatatgagcacac       c.*1200

          .         .         .         .         .         .       g.39345
 ccttgggggaaacaaagatgcccgagccgatcatgttccccacaatcaggcacacgccgt       c.*1260

          .         .         .         .         .         .       g.39405
 taagcagtgagatctccttcttcagcttcacctgctccggccctgggctggccccatcac       c.*1320

          .         .         .         .         .         .       g.39465
 ccaaaggggaggtttccacctcaggctgggaggccacttcatactcagtgctgtcaacca       c.*1380

          .         .         .         .    | 09    .         .    g.41404
 tggtggaggagaggaaacccttcaccagcttcctggcattgcc | tccttggtcctggatat    c.*1440

          .         .         .         .         .         .       g.41464
 aagcaggttctcacggcagtgtgagcagcagtcagggagagaagtgccttccaggatctg       c.*1500

          .         .         .         .         .      | 10  .    g.45710
 tggtctgatgctcctccttcccagccagcagtaaaagggaaggccagacaaatgc | ctgtc    c.*1560

          .         .         .         .         .         .       g.45770
 cagtgacctttgggcaggtgcggggaggaggggctaccagctgagtcaggggagagggga       c.*1620

          .         .         .         .         .         .       g.45830
 aggtgctagttaggagaaccaagcgtatcgctcatgctgcaacagctgttgactctgagg       c.*1680

          .         .         .         .          | 11        .              g.45890
 agcagaaaaagcagagggtaacggggactgaaatggaaaacaggaaaac | a              c.*1730

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Solute carrier family 7 (amino acid transporter light chain, y+L system), member 7 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.