(used for mutation description)
(last modified May 1, 2014)
This file was created to facilitate the description of sequence variants in the SOCS1 gene based on a coding DNA reference sequence following the HGVS recommendations.
The sequence was taken from NC_000016.9, covering SOCS1 transcript NM_003745.1.
(upstream sequence)
. . . . g.2706
ctggcggcggggcgcgggacgccgcgggcgggacggcggggggc c.-61
. . . . . . g.2766
tccggggcgctccggggcggctctcgcgcatgctccggggccaggagccgtgcagctgcc c.-1
| 02 . . . . . . g.2826
| C c.1
| ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? p.0
(downstream sequence)
Legend:
Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center