signal transducer and activator of transcription 3 (acute-phase response factor) (STAT3) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the STAT3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering STAT3 transcript NM_139276.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CAAACTGCCCTCCTGCTGAGGGTTCAGCACCTTCACCATTATTTCCAAACTGCATCAATG       c.60
 Q  T  A  L  L  L  R  V  Q  H  L  H  H  Y  F  Q  T  A  S  M         p.20

          .         .         .         .         .    | 02    .    g.400
 AATCTAAAGTGCGGGGGGACATCGGCAGGTCAATGGTATTGCTGCAGGTCGTT | GGTGTCA    c.120
 N  L  K  C  G  G  T  S  A  G  Q  W  Y  C  C  R  S  L  |  V  S      p.40

                                                                g.409
 CACAGATAA |                                                       c.130
 H  R  X                                                         p.42

          .         .        | 03.         .         .         .    g.5526
 acttggtcttcaggtatggggcagcgc | tacctgggtcagcttcaggatgctcctggctct    c.*60

          .         .         .         .         .         .       g.5586
 ctggccgacaatactttccgaatgcctcctccttgggaatgtcaggatagagatagacca       c.*120

          .         .         .         .         .         .       g.5646
 gtggagacaccaggatattggtagcatccatgatcttatagcccatgatgatttcagcaa       c.*180

          .         .         .         .         .         .       g.5706
 atgacatgttgttcagctgctgctttgtgtatggttccacggactggatctgggtcttac       c.*240

  | 04       .         .         .         .         .         .    g.6275
  | cgctgatgtccttctccacccaagtgaaagtgacgcctccttctttgctgctttcactga    c.*300

          .         .         .         .         .         .       g.6335
 atcttagcaggaaggtgcctggaggcttagtgctcaagatggcccgctcccgctccttac       c.*360

          .         . | 05       .         .         .         .    g.6511
 tgataaagcccatgatgtac | ccttcgttccaaagggccaggatgtactttttcacaaggt    c.*420

          .         .         .         .         .      | 06  .    g.6789
 caatgatattgtccagccagacccagaaggagaagcccttgccagccatgttttc | tttgc    c.*480

          .         .         .         .         | 07         .    g.7934
 aaaatttagcccatgtgatctgacaccctgaataattcacaccaggtc | ccaagagtttct    c.*540

          .         .         .         .         .         .       g.7994
 ctgccagtgtagtcagctgctcgatgctcagtcctcgcttggtggtggaggagaactgcc       c.*600

          .         .         .         .         .         .       g.8054
 agctcaggacctcggccacttgatcccaggttccaattgggggcttggtaaaaaagttta       c.*660

      | 08   .         .         .         .         .         .    g.8230
 catt | cttgggattgttggtcagcatgttgtaccacaggatggacgcccaggcatttggca    c.*720

          .         .         .         .    | 09    .         .    g.9344
 tctgacagatgttggagatcaccacaactggcaaggagtgggt | ctctaggtcaatcttga    c.*780

          .         .         .         .         .         .       g.9404
 ggccttggtgatacacctcggtctcaaaggtgatcaggtgcagctcctcagtcacaatca       c.*840

         | 10.         .         .         .         .      | 11  . g.12770
 gggaagc | atcacaattggctcggcccccattcccacatctctgctccctcagggt | caagt c.*900

          .         .         .         .         .         .       g.12830
 gtttgaattctgcagagaggctgccgttgttggattcttccatgttcatcacttttgtgt       c.*960

          .         .          | 12        .         .          | 13 g.14684
 ttgtgcccagaatgttaaatttccgggat | cctctgagagctgcaacgtccccagagtct | t c.*1020

          .         .         .         .         .          | 14    g.16885
 tgtcaatgcacactttaattttaagctgataattcaactcagggaatttgaccagcaac | c    c.*1080

          .         .         .         .         .         .       g.16945
 tgactttagtagtgaactggacgccggtcttgatgacgaggggccggtcaggatgcatgg       c.*1140

          .         .         .   | 15     .         .         .    g.17130
 gcatgcagggctgccgctccaccacaaaggca | cttttcattaagtttctaaacagctcca    c.*1200

          .         .         .         .         .         .       g.17190
 cgattctctcctccagcatcggccggtgctgtacaatggggtcccctttgtaggaaactt       c.*1260

          .         .         .         .         .         .       g.17250
 tttgctgcaactcctccagtttcttaatttgttgacgggtctgaagttgagattctgcta       c.*1320

          .  | 16      .         .         .         .         .    g.20695
 atgacgttatc | cagttttctagccgatctaggcagatgttgggcgggcctccaatgcagg    c.*1380

          .         .         .         .         .         .       g.20755
 caatctgttgccgcctcttccagtcagccagctcctcgtccgtgagagttttctgcacgt       c.*1440

          .         .         .         .    | 17    .         .    g.20991
 actccatcgctgacaaaagccccgccagctcactcacgatgct | tctccgcatctggtcca    c.*1500

          .         .         .         .         .         .       g.21051
 gcgcagtgagcatctgttccagctgctgcatcttctgcctggtcactgactggttgtttc       c.*1560

          .         | 18         .         .         .         .    g.21984
 cattcagatcttgcatgt | ctccttgactcttgagggttttatagttgaaatcaaagtcat    c.*1620

          .         .         .         . | 19       .         .    g.22545
 cctggagattctctaccactttcattttctgttctagatc | ctgcactctcttccggacat    c.*1680

          .         .         .         .         .         .       g.22605
 cctgaaggtgctgctccagcatctgctgcttctccgtcaccacggctgctgtggggtggt       c.*1740

          .       | 20 .         .         .         .         .    g.28814
 tggcctggcccccttg | ctgggccgcagtggctgcagtctgtagaaggcgtgattcttccc    c.*1800

          .         .         .         .         .      | 21  .    g.29785
 acaggcaccgggccacaatccgggcaatctccattggcttctcaagatacctgct | ctgaa    c.*1860

          .         .         .         .         .         .       g.29845
 gaaactgcttgattcttcgtagattgtgctgatagagaacattcgactcttgcaggaagc       c.*1920

          .         .         .         .         .         .       g.29905
 ggctatactgctggtcaatctctcccaggagattatgaaacaccaaagtggcatgtgatt       c.*1980

          .         . | 22       .         .         .         .    g.31640
 ctttgctggccgcatatgcc | caatcttgactctcaatccaaggggccagaaactgccgca    c.*2040

          .         .         .         .         .         .       g.31700
 gctccattgggaagctgtcactgtagagctgatggagctgctccaggtaccgtgtgtcaa       c.*2100

          .         .         .         .         .  | 23      .    g.71499
 gctgctgtagctgattccattgggccatcctgctaaaatcaggggtcccaa | ctgtttctc    c.*2160

          .         .         .         .         .         .       g.71559
 cggcagaggccgagaggccggggctgcgcgtgtgccggggacgggcggcgaggctccctc       c.*2220

          .         .         .         .         .         .       g.71619
 aggccgaagggcctctccgagccgagggggagagacagcgccaagccggggtgcctgtcc       c.*2280

          .         .         .         .         .         .       g.71679
 aggatccggttggggcttgttccctcggctgcgacgtcggaacccccggctccccctccc       c.*2340

          .         .         | 24         .         .         .                                   g.71739
 agtctgcgccgccgcagctccggaaacc | t                                   c.*2369

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Signal transducer and activator of transcription 3 (acute-phase response factor) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.