signal transducer and activator of transcription 5B (STAT5B) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the STAT5B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering STAT5B transcript NM_012448.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .                                               g.21
 TTCTGTGGGTACATGTTATAG                                              c.21
 F  C  G  Y  M  L  X                                                p.6

          .         .         .         .         .         .       g.81
 tgagcctggggacacacagctggggagggggcctggtccatgtacgtggcgctgccgccc       c.*60

          .         .        | 02.         .         .         .    g.450
 ccggcatctgcagatgcgttcacaaac | tcagggaccacttgcttgatctgtggcttcacg    c.*120

          .          | 03        .         .         .         .    g.5259
 tatccatcaacagctttag | cagtagcagactcgcagggaactggtgtgtagtatttggag    c.*180

          .         .         .         .         .         .       g.5319
 tatacttcatcttttggccgatcaggaaacacgtagataaggtaattcaagtctcccaag       c.*240

          .         .         .         .         .         .       g.5379
 cggtcggctagggaccgaatggagaagtctctggtggtaaaaggcatcagattccaaaac       c.*300

          . | 04       .         .         .         .         .    g.7881
 attctttcct | gagaatcaaacttccaagcaatggtgatgccgccaatttctgagtcactg    c.*360

          .         .         .         .         .         .       g.7941
 aatctcaggaggaaggtcccatctggcttgttaatgagtaggtcatgggcctgttgcttg       c.*420

          .         .  | 05      .         .         .         .    g.8102
 tttacaaaccccaaaatggcc | ccatcattccaatgaggcttgagatgtttttttaacact    c.*480

          .         .         .         .         .       | 06 .    g.9648
 tccatcacaccgtcaaaccattgccagaaagtgtaattccgtcctggtaaattctc | cctg    c.*540

          .         .         .         .         .         .       g.9708
 ttgaactgggaccaggacacagacaggccactgtagtcctccaggtggctgctgctgttg       c.*600

          .         .         .         .         .         .       g.9768
 ttgaacagtttctgcgccaggaacacgaggttctccttggtcaggccccggttgctctgc       c.*660

          .         .         .         .         .         .       g.9828
 acttcggccttgaatttcatgttgagcgcctcacacagctgtggccacagcactttgtca       c.*720

          .         .    | 07    .         .         .         .    g.13711
 ggcacggcaaatggcaccctgcc | aggctctgcaaaagcattgtcccagagaacagtggcc    c.*780

          .         .         .         .         .       | 08 .    g.14824
 gtcgcattgttgtcctggctgccatgaacgatcaccaccactggcagggacagggt | cttg    c.*840

          .         .         .         .         .         .       g.14884
 acttgaaaaaccagctcatttccaccaacactgaactgggattcaaacaggattgtaaat       c.*900

          .         .         .         .         .          | 09    g.15038
 ttttcttctgtcaccgactctgccccacgacggtctgacctcttaattcgtttcaggga | c    c.*960

          .         .         .         .         .         .       g.15098
 atattcctgaagtgggcactaagggtgcctgtggcttggtggtactccatgacgcagcag       c.*1020

          .         .        | 10.         .         .         .    g.15844
 ttgttcaagatctcgccactgtaatca | ttgcgggtgttctcgttcttgagcagagacttg    c.*1080

          .         .         .         .         .         .       g.15904
 gcctgctgctcactgatgatggtggccttcacctggggggggttcatgtgcacgttcagc       c.*1140

          .         .         .         .         .         .       g.15964
 ttcccgcccaccagcaggcgcacagtggctgcaaacttggtctgggtcttcaggacctga       c.*1200

          .         .        | 11.         .         .         .    g.16416
 ggaggctgcttctcaatgatgaacgtg | ctggtcaccagggctgagataatgtccgtgatg    c.*1260

          .         .         .         .         .         .       g.16476
 gtggcgttgacctcggccagcatctcctccactgggccggggatgggcagctgctggcag       c.*1320

          .         .         .         .         .         .       g.16536
 aggtgctcagccctgcggatctgctgccggttctgccagatgatctcggccaacttctca       c.*1380

     | 12    .         .         .         .         .         .    g.17029
 cac | caggactgtagcacgtccaggctgccctcggggggcccgccgttcccggccagctgc    c.*1440

          .         .         .         .         .         .       g.17089
 tgccgccgcttccactggatcagctcgtcatccaggatgatggtctgctgcttccgcagc       c.*1500

          .         .         .      | 13  .         .         .    g.17397
 agctgcagggtcttctggtgcttctcggccagctc | cacgcggtactgctgcagtgtctgt    c.*1560

          .         .         .         .         .         .       g.17457
 gcctcacgctgcaaccaggcctccagagacacctgcttctgctggagggccgtctcccgg       c.*1620

          .         .         .         .       | 14 .         .    g.21056
 ctcagacgctcctgggggctcagctgggccagcgggccaaactgag | cttggatcctcagg    c.*1680

          .         .         .         .         .         .       g.21116
 ctctcctggtactggatgatgaagtactcctgagtctgctgcagcttttttaactcattc       c.*1740

          .         .         .         .         .         .       g.21176
 tctgtgtcctgcgtgaccagtcgcagctcctcaaacgtctggttgatctggaggtgtttc       c.*1800

          .         .         .         .  | 15      .         .    g.22458
 tgggacatggcatcagcaaggcttccagctggagagctacc | attgttggcttctcggacc    c.*1860

          .         .         .         .         .         .       g.22518
 aacctctgttcattgtacaatatatggcggatgcagcggaccagctccatggggcagcgg       c.*1920

          .  | 16      .         .         .         .         .    g.25238
 tcatacgtgtt | ctggagctgtgtggcatagtgccccagcttgatcttcagtaaaaaccca    c.*1980

          .         .         .         .         .         .       g.25298
 tcttcccccacctggtgctctgccttcttctgcagctcctgcaccaggccctccaggagc       c.*2040

          .         .         .         .         | 17         .    g.29672
 tgggtggccttaatgttctcctgtggattatcaagatctactgagtcc | catgcttggctt    c.*2100

          .         .         .         .         .         .       g.29732
 tcaatccactgggataaataatgccgcacctcaatgggaaaatgctggccatataacgct       c.*2160

          .         .         .         .         .         .       g.29792
 tgcatctgatgaagggcttctccttggagctgctgagcttgtatccacacagccatggtt       c.*2220

        | 18 .         .         .         .         .         .    g.73962
 tacaat | ctcgctcggcccctcgggcgcccgcggctgctccggcccagctgtctggcttgc    c.*2280

          .         .         .         .         .         .       g.74022
 ccgcccgcccgctcgctccctccctcggccgggccgccgcgcggagttgcctgcgctggg       c.*2340

          .         .         .         .      | 19  .         .                  g.74082
 tccccgcccggggtgacggctccggccgccgactctcctcccgcc | g                  c.*2386

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Signal transducer and activator of transcription 5B protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.