transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (TAP1) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the TAP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering TAP1 transcript NM_000593.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.6
 CTGTAA                                                             c.6
 L  X                                                               p.1

          .         .         .         .         .         .       g.66
 ctggctgtttgcatccagggcactggtggcatcatccaggataagtacacacggtttccg       c.*60

          .         .         .         .         .         .       g.126
 gatcaatgctcgggccaacgccactgcctgtcgctgaccccctgacagctggctcccagc       c.*120

          .  | 02      .         .         .         .         .    g.494
 ctcgtctacct | ctgtgtcatagccctgagggagtccagagatgaaactatgggccccaga    c.*180

          .         .         .         .         .         .       g.554
 ctttactgcagcagctgtgatttcctccatagttggcttctgggtcaggccataggcaat       c.*240

          .         .         .         .         .     | 03   .    g.857
 attttcttgaagacttcttccaaatacctgtggctcttgtcccactgcagccac | ctgcct    c.*300

          .         .         .         .         .         .       g.917
 gtgcaggtagcggtgctcatattggggaaggggcttcccatccaacagcagctgtccccc       c.*360

          .         .         .         .         .         .       g.977
 ggtgggctggtacagattctgcagcagggcagccactgtgctcttcccagacccattggg       c.*420

          .         .         .         .         | 04         .    g.1596
 tcccaccagcgccgtcacctcgccagggcgtagggtgaatgtcagccc | ctgtagcactaa    c.*480

          .         .         .         .         .         .       g.1656
 gacatctgggcggtttgggtaggcaaaggagacatcttggaactggacaaggccctccaa       c.*540

          .         .         .         .         .         .       g.1716
 gtgtaagggagtcaacagaccactgggtgggcagcgaggggtgcggtccaggtactcaaa       c.*600

          .         .         .         .         .        | 05.    g.1925
 tattttctctgaggagcccacagccttctgtactctggggtagatggagagcagtac | ctc    c.*660

          .         .         .         .         .         .       g.1985
 cacagcctgggtgaactgcatctggtagagaacaaatgtgacaaggttcccactgcttac       c.*720

          .         .         .         .         .         .       g.2045
 agccccactggtcaccagctgcccaccaatgtagaggattcccactttcagcagcatacc       c.*780

        | 06 .         .         .         .         .         .    g.3306
 tgaaat | actagtggtccaggagttgactgcataggccacagcctccttctggttgagtgt    c.*840

          .         .         .         .         .         .       g.3366
 ctttatttcttgcagcttttccctaaacttctgggcttcgccctcctcgttggcaaagct       c.*900

          .         .         .         .         .         .       g.3426
 tcgaactgtaggcatggccgacagagcctcaatggccacctggctggactttgccagaga       c.*960

          .         .     | 07   .         .         .         .    g.3912
 ttcccgcacctgcacttccagcaa | ctggtaccattttcccaccttcttgggcagaaggaa    c.*1020

          .         .         .         .         .         .       g.3972
 aagcagaggcagggtgatcagggtgaccatggtgagggacactgatccccagagcatgat       c.*1080

          .         .         .         .         .         .       g.4032
 ccccaagagacataggcctcgcaccaggtaccacagaaataagctcagattctcactcag       c.*1140

          .         .         .         .         . | 08       .    g.5051
 agaatcactcagggtggacgtgtcctctgttacccgagacatgatgttac | ctgtctggtt    c.*1200

          .         .         .         .         .         .       g.5111
 ctgttggaaaaactccgtctcctggcgcaggacagccccaaacacctctccctgcaagtg       c.*1260

          .         .         .         .         .         .       g.5171
 gctgtgcacgtggcccatggtgttgttatagatcccgtcacccacgaactccagcactgc       c.*1320

   | 09      .         .         .         .         .         .    g.5379
 a | ctggctatggtgagaatggacatgagagttaagtttcgagtgaaggtatcggctgagcc    c.*1380

          .         .         .         .         .       | 10 .    g.5975
 atcttgtagaatccagtcagtgaggcggcccgtaaagaatggaatggccatctccc | caag    c.*1440

          .         .         .         .         .         .       g.6035
 agaggagaggaccaccaggaccaggaacagcgagaggcggcgcgtctccgagcccaggca       c.*1500

          .         .         .         .         .         .       g.6095
 gcctagaagccgacgcacagggtttccagagccgccctgaccgccgggcacccagaggct       c.*1560

          .         .         .         .         .         .       g.6155
 cccgagtttgtgccacagggctgctgcgggcagtgccgctgcataactgacaacgaaggc       c.*1620

          .         .         .         .         .         .       g.6215
 ggtagggtgacttccccagtgcagtagcctggtgctatccgcggacccgggggctcccca       c.*1680

          .         .         .         .         .         .       g.6275
 tgagatcagctctcggaacaaggcaagtcccggcagggccaagcccagtgccgcagctaa       c.*1740

          .         .         .         .         .         .       g.6335
 tggcttcaaagcagccagccagccctgggcacctgcgttttcgctcttggagccaaccgt       c.*1800

          .         .         .         .         .         .       g.6395
 tgccctgaggaccccgcaggcccccagccagagcacggcccagcggctcaggcccaccgc       c.*1860

          .         .         .         .         .         .       g.6455
 ccagacccggagcagtggcagcgcggtgggcaccagcagggagaatatgcggggcagcgc       c.*1920

          .         .         .         .         .         .       g.6515
 ggtccggagcagcacccagtcggcgagaagtagcagtactgtccccagccatgcgagaga       c.*1980

          .         .         .         .         .         .       g.6575
 agctccggggaggcagcggcacccgcggggagcgggacacctagagctagccattggcac       c.*2040

          .         .         .         .         .         .       g.6635
 tcggacgccgtcccggtcccggccgggcctgggactctccgcgccccggtggggcctgaa       c.*2100

          .         .         .         .         .         .       g.6695
 gctccgggtaccgccgagtcctcccctactggcggctgggggagggaacgagggcggggc       c.*2160

          .         .         .         .         .         .       g.6755
 tctcggaaagtcccaggaacaggctgatcctgcgctggcgagaagctcagccatttaggg       c.*2220

          .         .         .         .         .         .       g.6815
 gaaagcgaaatcgaaagcggccgcctgctcactagataacgcctacttccaaaagtggcc       c.*2280

          .         .         .         .         .         .       g.6875
 tgcccagactattttggtagcaagcgtggaaatcagatctgagaatctcgggagcagccc       c.*2340

          .         .          | 11        .         .         .                                  g.6935
 tggtgcccaattttctccatcacgcacac | c                                  c.*2370

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.