TAP binding protein (tapasin) (TAPBP) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the TAPBP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering TAPBP transcript NM_003190.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                g.9
 CTTCTTTGA |                                                       c.10
 L  L  X                                                         p.2

          .         .       | 02 .         .         .         .    g.207
 atccttgcaggtggacaggtagacag | cagcccagcccagtgccttgaagagcccaagcag    c.*60

          .         .         .         .         .       | 03 .    g.346
 aagaaaggcagacaggaaaaggcctacgctgtcctcaagggagggccctgaaagac | ctgc    c.*120

          .         .         .         .         .         .       g.406
 tacctccagggtgacctcagcgctgcgccccgaggcaggcaggctgggatggtgaattcg       c.*180

          .         .         .         .         .         .       g.466
 acaggcatagcgtgccccatgctgctcagtggtgactgggggcggctgcaagtgcccaga       c.*240

          .         .         .         .         .         .       g.526
 gaggctgacagagccatcggaatggtggcgcagggccgagagccacctctgcccctcggc       c.*300

          .         .         .         .         .         .       g.586
 cttctgagagcggccccctgggccaccccggagttcccactccacctccaggcccccaga       c.*360

          .         .         .         .         .         .       g.646
 agggtagaagtgggacacaaggcagagcaattccgggggtgcctcccctggggcggcccg       c.*420

          .         .         .         | 04         .         .    g.1056
 tgcaagggttgctggcatcagggacactttggggggtt | tgtacacagcaagctccagggt    c.*480

          .         .         .         .         .         .       g.1116
 gacctgtccttgcaggtatggcaggtgtatggtggccagataggtgccctcctgaaaggg       c.*540

          .         .         .         .         .         .       g.1176
 ttgaactgtaggcagccagaaggtcccatttccggtccatgggccccatggctcatcatc       c.*600

          .         .         .         .         .         .       g.1236
 atcccaagcagcaaatgccacggccccttcttgggctgctggcatctggccattcagccc       c.*660

          .         .         .         .         .         .       g.1296
 aggagttgcagccaggagcagatgtcccttacccaggtgctggcgtcgccactctagccc       c.*720

          .         .         .         .         .         .       g.1356
 aaagggagggggacccggagccagagatgaggcggcctcggaggtggggggcatgtaggc       c.*780

          .         .         .         .         .         .       g.1416
 aaagctcaagtccagcagagcatcttgtcccagtctcactcgaggggcaggggtgtgggt       c.*840

          .        | 05.         .         .         .         .    g.9305
 gaggacagtcagtacca | ctgttgccatggtgatgagaacaggctcctgctgaggctctgg    c.*900

          .         .         .         .         .         .       g.9365
 ctgtggtcgcaagaggctggagaggctgaggactgggctggatatgctgaccatcagcca       c.*960

          .         .         .         .         .         .       g.9425
 agccccatccagggcccgcgggcagttctgcgcgggggtcaggccgctggcccatttcgc       c.*1020

          .         .         .         .         .         .       g.9485
 agaggcggggagaggcacgaagcggctcatctcgcagtgtggtgcgggggcgccccgggg       c.*1080

          .         .         .         | 06         .         .    g.9761
 ataccgcctgaaggcagcctggagggcgcccgcggggt | cgtgtacactgagatagagctc    c.*1140

          .         .         .         .         .         .       g.9821
 agggtcgaggtccggccggggcggcggttcccccggtccctggcgcaacagcagtgcacc       c.*1200

          .         .         .         .         .         .       g.9881
 gggtctcttggccaggccctttccgctcgcatcctccacgaaccaacactcgatcaccgc       c.*1260

          .         .          | 07        .         .         .    g.10081
 gggtcctgctgagacggcggtcgccaggc | ccaaagccacagcgaggagcagagacaggga    c.*1320

          .         .         .         .         .         .       g.10141
 cttcatggcgctgcgacctcctcagccatgaagcctcctcttcctcctttcactttcact       c.*1380

          .         .         .         .         .         .       g.10201
 ttcctccaaagggcggcatgaggggcggtggaaatccccgctctggttaggtgaaggtgc       c.*1440

          .         .         .         .         .         .       g.10261
 ctgggggaccggtgtttccccactggccaggcagggacccgggtagatcctctccagttc       c.*1500

          .         .         .         .         .         .       g.10321
 tcaccaggacaccccagccttaccgcgccctcctggactacccagcagccccgagttcga       c.*1560

          .         .         .         .         .         .       g.10381
 gccctccccaaccccaggccctcccccgccccccaactcctgtgtgtgctctccaacatc       c.*1620

          .         .         .         .         .   | 08     .           g.10441
 cacttgcccgaaaaccattactccggcttccccctatctgtgccgcgtcccc | c           c.*1673

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The TAP binding protein (tapasin) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.