(intronic numbering for coding DNA Reference Sequence)
. . . g.10161
gtgagtgtcctcccccgagagagtgagcgccgggcgcc c.908+38
--------------------- middle of intron ---------------------
g.10162 . . . g.10199
c.909-38 tggcgcaggcgccgccctgatccgcctcccgcccgcag c.909-1
Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center