telomerase reverse transcriptase (TERT) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the TERT gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000005.9, covering TERT transcript NM_198253.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.9
 CTGTCCTGA                                                          c.9
 L  S  X                                                            p.2

          .         .         .         .         .         .       g.69
 gtgaccccaggagtggcacgtaggtgacacggtgtcgagtcagcttgagcaggaatgctt       c.*60

          .         .         .         .         .         .       g.129
 ggtggcacagccactgcacggcctcggagggcagagggccggcggcgcccttggccccca       c.*120

           | 02        .         .         .         .         .    g.970
 gcgacatcc | ctgcgttcttggctttcaggatggagtagcagagggaggccgtgtcagaga    c.*180

          .         .         .         .         .         .       g.1030
 tgacgcgcaggaaaaatgtggggttcttccaaacttgctgatgaaatgggagctgcagca       c.*240

          .     | 03   .         .         .         .         .    g.4276
 cacatgcgtgaaac | ctgtacgcctgcagcaggaggatcttgtagatgttggtgcacaccg    c.*300

          .       | 04 .         .         .         .         .    g.6150
 tctggaggctgttcac | ctgcaaatccagaaacaggctgtgacacttcagccgcaagaccc    c.*360

          .         .         .         .         .         .       g.6210
 caaagagtttgcgacgcatgttcctcccagccttgaagccgcggttgaaggtgagactgg       c.*420

          .         .    | 05    .         .         .         .    g.10073
 ctctgatggaggtccgggcatag | ctggagtagtcgctctgcacctccagggtccgggtat    c.*480

          .         .         .         .         .         .       g.10133
 ccagcagcaggccgcaccaggggaataggccgtgggccggcatctgaacaaaagccgtgc       c.*540

          .         .         .         .         .         .       g.10193
 cacccagggcctcgtcttctacagggaagttcaccactgtcttccgcaagttcaccacgc       c.*600

          .         .         .   | 06     .         .         .    g.12124
 agccatactcagggacacctcggaccagggtc | ctgaggaaggttttcgcgtgggtgaggt    c.*660

          .         .         .         .     | 07   .         .    g.14168
 gaggtgtcaccaacaagaaatcatccaccaaacgcaggagcagc | ccgtcccgccgaatcc    c.*720

          .         .         .         .         .         .       g.14228
 ccgcaaacagcttgttctccatgtcgccgtagcacaggctgcagagcagcgtggagagga       c.*780

          .         .         .         | 08         .         .    g.16773
 tggagccctgcgggatcccctggcactggacgtaggac | ttgcccctgatgcgcacggcgt    c.*840

          .         .         .         .         .         .       g.16833
 ggtggcacatgaagcgtaggaagacgtcgaagaggccactgctggcctcattcagggagg       c.*900

      | 09   .         .         .         .         .         .    g.17873
 agct | ctgctcgatgacgacggcatccctcagcgggctggtctcctgcaggtgagccacga    c.*960

          .         .         .         . | 10       .         .    g.24293
 actgtcgcatgtacggctggaggtctgtcaaggtagagac | gtggctcttgaaggccttgc    c.*1020

          .         .         .         .         .         .       g.24353
 ggacgtgcccatgggcggccttctggaccacggcataccgacgcacgcagtacgtgttct       c.*1080

          .         .         .         .         .         .       g.24413
 ggggtttgatgatgctggcgatgacctccgtgagcctgtcctgggggatggtgtcgtacg       c.*1140

          .       | 11 .         .         .         .         .    g.24967
 cgcccgtcacatccac | cttgacaaagtacagctcaggcggcgggtcctgggcccgcacac    c.*1200

          .         .         .         .         .         .       g.25027
 gcagcacgaaggtgcgccaggccctgtggatatcgtccaggcccagcacagaggcgccca       c.*1260

          .         .         .         .         .         .       g.25087
 ggaggccggggcgccgcgcccgctcgtagttgagcacgctgaacagtgccttcaccctcg       c.*1320

          .       | 12 .         .         .         .         .    g.25834
 aggtgagacgctcggc | cctcttttctctgcggaacgttctggctcccacgacgtagtcca    c.*1380

          .         .         .         .         .         .       g.25894
 tgttcacaatcggccgcagcccgtcaggcttggggatgaagcggagtctggacgtcagca       c.*1440

          .         .         .         .         .         .       g.25954
 gggcgggcctggcttcccgatgctgcctgacctctgcttccgacagctcccgcagctgca       c.*1500

          .        | 13.         .         .         .         .    g.28104
 ccctcttcaagtgctgt | ctgattccaatgctttgcaacttgctccagacactcttccggt    c.*1560

          .         .         .         .         .         .       g.28164
 agaaaaagagcctgttcttttgaaacgtggtctccgtgacataaaagaaagacctgagca       c.*1620

          .         .         .         .         .         .       g.28224
 gctcgacgacgtacacactcatcagccagtgcaggaacttggccaggatctcctcacgca       c.*1680

          .         .         .    | 14    .         .         .    g.38972
 gacggtgctctgcggccggaacacagccaaccc | ctgggctcctgcgcagccaagcgcagt    c.*1740

          .         .         .         .         .         .       g.39032
 cccgcacgctcatcttccacgtcagctcctgcagcgagagcttggcatgcttccccaggg       c.*1800

          .         .         .         .         .         .       g.39092
 agatgaacttcttggtgttcctgaggaagcggcgttcgttgtgcctggagccccagaggc       c.*1860

          .         .         .         .         .         .       g.39152
 ctgggggcaccagccggcgcaggcaggcccgcacgaagccgtacacctgccaggggctgc       c.*1920

          .         .         .         .         .         .       g.39212
 tgtgctggcggagcagctgcaccaggcgacgggggtctgtgtcctcctcctcgggggccg       c.*1980

          .         .         .         .         .         .       g.39272
 ccacagagccctggggcttctcccgggcacagacaccggctgctggggtgaccgcagctc       c.*2040

          .         .         .         .         .         .       g.39332
 gcagcgggcagtgcgtcttgaggagcaccccgtaggggcactgcgcgtggttcccaagca       c.*2100

          .         .         .         .         .         .       g.39392
 gctccagaaacaggggccgcatttgccagtagcgctggggcaggcggggcaacctgcggg       c.*2160

          .         .         .         .         .         .       g.39452
 gagtccctggcatccagggcctggaacccagaaagatggtctccacgagcctccgagcgc       c.*2220

          .         .         .         .         .         .       g.39512
 cagtcaggctgggcctcagagagctgagtaggaaggagggccgcagctgctccttgtcgc       c.*2280

          .         .         .         .         .         .       g.39572
 ctgaggagtagaggaagtgcttggtctcggcgtacaccgggggacaaggcgtgtcccagg       c.*2340

          .         .         .         .         .         .       g.39632
 gacgtggtggccgcgatgtggatggggggcccgcgtggtgctggcggcccacggatgggt       c.*2400

          .         .         .         .         .         .       g.39692
 gggagtggcgcgtgccagagagcgcaccctccaaagaggtggcttcttcggcgggtctgg       c.*2460

          .         .         .         .         .         .       g.39752
 caggtgacaccacacagaaaccacggtcactcggtccacgcgtcctgcccgggtgggccc       c.*2520

          .         .         .         .         .         .       g.39812
 aggacccctgcccaacgggcgtccgctccggctcaggggcagcgccacgcctgggcctct       c.*2580

          .         .         .         .         .         .       g.39872
 tgggcaacggcagacttcggctggcactgcccccgcgcctcctcgcacccggggctggca       c.*2640

          .         .         .         .         .         .       g.39932
 ggcccagggggaccccggcctccctgacgctatggttccaggcccgttcgcatcccagac       c.*2700

          .         .         .         .         .         .       g.39992
 gccttcggggtccactagcgtgtggcgggggccgggcctgagtggcagcgccgagctggt       c.*2760

          .         .         .         .         .         .       g.40052
 acagcggcggcccgcacacctggtaggcgcagctgggagccaccagcacaaagagcgcgc       c.*2820

          .         .         .         .         .         .       g.40112
 agcgtgccagcaggtgaaccagcacgtcgtcgcccacgcggcgcagcagcagcccccacg       c.*2880

          .         .         .         .         .         .       g.40172
 ccccgctcccccgcagtgcgtcggtcaccgtgttgggcaggtagctgcgcacgctggtgg       c.*2940

          .         .         .         .         .         .       g.40232
 tgaaggcctcgggggggcccccgcgggccccgtccagcagcgcgaagccgaaggccagca       c.*3000

          .         .         .         .         .         .       g.40292
 cgttcttcgcgccgcgctcgcacagcctctgcagcactcgggccaccagctccttcaggc       c.*3060

         | 15.         .         .         .         .         .    g.40456
 aggacac | ctggcggaaggagggggcggcggggggcggccgtgcgtcccagggcacgcaca    c.*3120

          .         .         .         .         .         .       g.40516
 ccaggcactgggccaccagcgcgcggaaagccgccgggtccccgcgctgcaccagccgcc       c.*3180

          .         .         .         .         .         .       g.40576
 agccctggggccccaggcgccgcacgaacgtggccagcggcagcacctcgcggtagtggc       c.*3240

          .         .         .         .         .         .       g.40636
 tgcgcagcagggagcgcacggctcggcagcggggagcgcgcggcatcgcgggggtggccg       c.*3300

          .         .         .         .     | 16   .         .                   g.40696
 gggccagggcttcccacgtgcgcagcaggacgcagcgctgcctg | c                   c.*3345

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Telomerase reverse transcriptase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.