TERF1 (TRF1)-interacting nuclear factor 2 (TINF2) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the TINF2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000014.8, covering TINF2 transcript NM_001099274.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .                           g.42
 CTTTCCTTCCCCCTGGCCATTTTCTTCCTCATCAGAGTCTAA                         c.42
 L  S  F  P  L  A  I  F  F  L  I  R  V  X                           p.13

          .         .         .         .         . | 02       .    g.209
 aaccaagtcccctatggtaatgacggagctgcacagagacggaggacaca | ctggcttcct    c.*60

          .         .         .         .         .         | 03    g.357
 ggccctaggaggtaataatgatagtctcagggggtccatgtagcaatccaagcaattc | tc    c.*120

          .         .         .         .         .         .       g.417
 cttttgctctgtggcaggcaagtcaactgggttctccttcagagcccttccccccagggt       c.*180

          .         .         .         .         .         .       g.477
 ctggcatggactcttagacttcccagtggaggctgctcttgtgcccatggctaggtctgc       c.*240

          .         .         .         .         .         .       g.537
 tgtgtatatcgcatgttcttccttgctctcaggcttagatatgacctgggttggtgagcc       c.*300

          .         .         .         .         .         .       g.597
 gagattcctaaagggaaacagcatgactgtggggcgctccttatggcctcccctagtgga       c.*360

          .         .         .         .         .         .       g.657
 ggcccattgggactgaactcttcgtcggcctagaggggccagattgaagtgtcggccagc       c.*420

          .         .         .         .         .         .       g.717
 tagaggttctgggtgcgtccttgaagatggtccctgaggaagatgtgtgccaggcttggc       c.*480

          .         .         .         .         .         .       g.777
 ttttggcaggggattgtggagtgctagtctttgttgctgaggaggattctgttccatggg       c.*540

          .         .         .      | 04  .         .         .    g.981
 ctcagccaggttcactgagtcagtaacagagcact | ctggaagcagccaccccatgtccac    c.*600

          .         .         .         .         .         .       g.1041
 accatattgtctccaggcaagagaagaggtgatagagactccaggctgcatccaactcag       c.*660

          .   | 05     .         .         .         .         .    g.1188
 cacatcctgaag | ctgctgtgcctgcggtgtaggcagtgctttctccagctgacacaagta    c.*720

          .         .         .         .         .         .       g.1248
 ctcaaaaagcagcttttccatggcagccagaaagggttccccatactcttgttcaagttc       c.*780

  | 06       .         .         .         .         .         .    g.1671
  | ctgcagcttcgaggccaaatccacaggagcctctgacagctgcttcacctgctggtaaaa    c.*840

          .         .         .         .   | 07     .         .    g.1844
 agtttcctgtgcctccaaaatcttcctcagatcctgctttgt | agccttgggatcccgcac    c.*900

          .         .         .         .         .         .       g.1904
 tataggtccagattctggaaagtggtgattcagggctttcaggacttgggcccaaggccg       c.*960

          .         .        | 08.         .         .         .    g.2110
 gccctgcaggatcagctccaccaccac | cttggcctttaggcccatacaaaggcgttcgtg    c.*1020

          .         .         .         .         .         .       g.2170
 gtgccggtagcgaaccaagccaggggcaacagcgcgcagagatcgcagaaactccagtac       c.*1080

          .         .         .         .         .         .       g.2230
 tcgcggaaaatgttccacgcagcgtccgcgcacaacctgccagctagccgcggcggcgaa       c.*1140

          .         .         .         .         .         .       g.2290
 gcgtagagctgcgggacccgccaccaggggcgtagccatggtcggcgggctccgcccgga       c.*1200

          .         .         .         .         .         .       g.2350
 ggcggtccctccgggttcctcacccggatgggtgaggctttccgatcactcctaggggcg       c.*1260

          .         .         .         .         .         .       g.2410
 gggcttctggcaactccctgtcgctccggtctgtcggctctgggtacctcgcgatctgac       c.*1320

          .         .         .         .         .         .       g.2470
 tcggctcccttccatcggcccccagaattctgggggagggggtcttctggctcgggctgg       c.*1380

          .         .         .         .         .         .       g.2530
 aggagcctgagtggagaagctgaccgtctccagtggcactgggtcgctcagctttaaacg       c.*1440

          .         .         .         .         .         .       g.2590
 tcgccgctgtctcgagcccgagggtgcctcacttccggctccgctactagcttcccttgc       c.*1500

          .         .  | 09      .         .         .         .                                          g.2650
 cccggaaaagggcggtaagag | a                                          c.*1522

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The TERF1 (TRF1)-interacting nuclear factor 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.