transmembrane channel-like 6 (TMC6) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the TMC6 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering TMC6 transcript NM_007267.6.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .                                     g.33
 CTGCTCCTCTCCTCCCTCTCCTTCCTCTCGTAG                                  c.33
 L  L  L  S  S  L  S  F  L  S  X                                    p.10

          .         .         .         .     | 02   .         .    g.3737
 atggagtgaagcttgttgattaagaagattttgtcctcaccctc | attgctgatctgctcc    c.*60

          .         .         .         .         .         .       g.3797
 ttgagcaggcagatgaccttgcgctggccccgcaccacctggatgttgaggtagatcacg       c.*120

     | 03    .         .         .         .         .         .    g.3977
 gcc | agcagcagggctgacaccaggaagacaaagaaggtgttttccatcaggtaccggtgc    c.*180

          .         .         .         .         .         .       g.4037
 acccagggcagccaggagaccctggggcctgccgcctccaggtggcgcacccacaccctg       c.*240

          .         .         .         .         .         .       g.4097
 ccggcctcgtacatggtgtccagggtccggaaggggccgcaggtgctcgagggcttcacc       c.*300

  | 04       .         .         .         .         .         .    g.4314
  | tgccagacggcgtagcagaggaagacagcggcgcccaggaaggcggggaagcagagcagc    c.*360

          .         .         .         .         .         .       g.4374
 gtgaggaagacggtgctcatgtgtgaggccagccagggccggcgcggcgcctggcagttg       c.*420

          .     | 05   .         .         .         .         .    g.5469
 gccagaaggctggt | cttcttgacatagaagacgagcagcagcttgatgatctgcacggcg    c.*480

          .         .         . | 06       .         .         .    g.5779
 gggaggaggggcgagaagagcacccccagc | caggtcagagtctgcccataaatcagctcc    c.*540

          .         .         .         .         .         .       g.5839
 aggacattccgggcaatgtcaaactccggcttccgcctcctcttcagcttcttctcggag       c.*600

        | 07 .         .         .         .         .         .    g.7159
 ataatc | ctccacaccagttccccaaaaagcgtgtccagcaacatgaggacgaagtccatc    c.*660

          .         .         .         .         .         .       g.7219
 accaggaaccggtacagctcctggcccacaaaatcctcccagcactggccctgcaggacg       c.*720

          .         .         .         .         .         .       g.7279
 cccaccctgcggcccagccagtggtagcacagtgtccccaggatggccagcttgaggatg       c.*780

        | 08 .         .         .         .         .         .    g.7519
 aggttc | ctgcagatggccacgtacacctccagtaccggggagtcatgcggctccagggcg    c.*840

          .         .         .         .         .         .       g.7579
 gccaggacacggcacaggtagggggcccccaggttgaggaggccaaccaccaggggcagg       c.*900

          .         .         .         | 09         .         .    g.8030
 accagcagcacagcctcctggccagcagcctctggact | ctggatcatgaactccgagaag    c.*960

          .         .         .         .         .         .       g.8090
 acgtggacggccacggcgcagcccagcgcggtccccagacacagcagccacacaagcccc       c.*1020

          .         .         .         .         .         .       g.8150
 agcacagccgcctgccgcagcctcccgcacacgctcctggggctgtgccgcagctgccac       c.*1080

          .     | 10   .         .         .         .         .    g.9103
 tcggccagcagctc | cttcagccgggtgcgaatattgtcctgctggaggcgggaggcccgc    c.*1140

          .         .         .         .         .         .       g.9163
 ttctgcgtcaccttgtagtcccaggagcagaagacggtgatggcgtggatgccagaggtg       c.*1200

          .         .         .          | 11        .         .    g.10462
 ctgcccacccggtagctctccccgaaagagtgagccatg | ctgtacaccagggtgatgcag    c.*1260

          .         .         .         .         .         .       g.10522
 gtgataaagaagctcacgcccacagtggagaggtaggccaggggcatgttgtagggcagg       c.*1320

          .         .         .         .         .         .       g.10582
 ccacccaccctgggtgtgcactggctgccatccagggggctgccacacggctggttcagc       c.*1380

          .         .         .         .         . | 12       .    g.10986
 gtggcgttactgtagtggccgtagtacatgacggtgtgggtgaagcaacc | cgcgcctgtg    c.*1440

          .         .         .         .         .         .       g.11046
 aggagctccaggcctgtgcagacgggggcagggcccggcagggcgggtgggaaggcgacc       c.*1500

          .         .         .         .         .         .       g.11106
 tgagggcccatgatgaaggccaccagcagcagcagcaggagggcattgaaagccagcagg       c.*1560

          .         .         .         .         .         .       g.11166
 gtcttgagaaagaggaagtaggagagcacgctggagccgaactggcccccgatgcgcttc       c.*1620

          .         .         .         .         .         .       g.11226
 agggcgtagcgccacggcatcagggcctgcagggcggagagcagcgccaggcccaggctg       c.*1680

          | 13         .         .         .         .         .    g.11393
 tgcaaggc | cagcacgcaggcatatctgagccggccacagcaggagcagaccccgccgctg    c.*1740

          .         .         .         .      | 14  .         .    g.11625
 cccggctggcccctccacttccccctcggggtcctgctcttctct | cgcaggctgcgtttc    c.*1800

          .         .         .         .         .         .       g.11685
 tcagccaggcttaagggcatcccgcgaagcatgtggtcccgctgtgccactgccaggctc       c.*1860

          .         .         .  | 15      .         .         .    g.12207
 tggagctccttcaccaggaggctctgcttct | cctcctcctccagggccgtggggtccagc    c.*1920

          .         .         .         .         .         .       g.12267
 tccaggtcgtacaggcggaggctgggccaggcggagcggacaaagttcccgagcaggggc       c.*1980

          .         .         .         .         .         .       g.12327
 cggctgctcctgcaccgaagctgcaccgtgcggttgtagtactgggagatgatggcacct       c.*2040

          . | 16       .         .         .         .         .    g.12779
 cggctgcggc | caatggtgcggctgggcatgctggccaggatgcggagtgtggccgtgctc    c.*2100

          .         .         .         . | 17       .         .    g.12996
 tgggtgccctcgggccgccagagtgtctgctggctacttc | ctgtcacctcccgctctctc    c.*2160

          .         .         .         .         .         .       g.13056
 tgctgcagctccagcccctcctgggccgtgcactggctctgctcctggatgagctgctgg       c.*2220

          .         .         .         .      | 18  .         .    g.13244
 aaggagtcgtgcacttcgctttcatcataggggctggggccctgg | ccctggtcccctggg    c.*2280

          .         .         .         .         .         .       g.13304
 gtctcagggacatcgaggatgaaggccagtggctgggccatgtctctggccaatgcccgc       c.*2340

          .         .         .         .         .      | 19  .    g.18798
 tagtctgcagacctagggtagctcagagcctgggcgccacctccggagcccccat | cctgc    c.*2400

          .         .         .         .         .         .       g.18858
 tctcccactgcaggcctcttcggcacaggaattcggtcctacttcaccttcctccgcttc       c.*2460

    | 20     .         .         .         .         .         .                                                             g.18918
 ct | t                                                             c.*2463

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transmembrane channel-like 6 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.