tumor necrosis factor receptor superfamily, member 13B (TNFRSF13B) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the TNFRSF13B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering TNFRSF13B transcript NM_012452.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CCTGGGAAGACTTGGCCGGACTTTGACGGGGCCTTGAGCGGGGCTGGCAGGAGCAGGGAT       c.60
 P  G  K  T  W  P  D  F  D  G  A  L  S  G  A  G  R  S  R  D         p.20

          .                                                         g.75
 CCCCCCTCTTCTTGA                                                    c.75
 P  P  S  S  X                                                      p.24

          .         .         .         .         .         .       g.135
 ggaagcaggccaccgccaccaggaagcagcagaggacggcacacaggcagagccccagcg       c.*60

          .         .         .         .         .  | 02      .    g.8421
 tgctgtagaccagggccacctgatctgcactcagcttcagccccgggagag | ctggacttg    c.*120

          .         .         .         .         .         .       g.8481
 cttctgagcctctgtgctccaatccttggtaccttcccgagttgtctgaattgttttcaa       c.*180

          .         .         .         .         .         .       g.8541
 cttctccactccgctgtctcctgagctctggtggaaggttcactgggctcctgagcttgt       c.*240

          .         .         .         .         .         .       g.8601
 tctcacagaagtatgcacattgcttagggtgctgtccacagatggaggcacagctgatgc       c.*300

          .         .         .         .         .        | 03.    g.12123
 agtccctcaggagatggtcatagaacttgccttgctccttgcggcagctgagtgacc | tgc    c.*360

          .         .         .         .         .         .       g.12183
 agaaggctgcacaggtgcgctggctctgatggttgcaaatggttttgcaggacatgcagg       c.*420

          .         .         .         .         .         .       g.12243
 tacccagcagaggatcccagtactgctcttcggggcaggatctcatagccacccccgtcc       c.*480

          .      | 04  .         .         .         .         .    g.31734
 acaggccctgtggaa | agcgctcctcctggtccacacggctccggccacctcgcctgctcc    c.*540

          .         .          | 05        .         .         .                                  g.31794
 ggcccaggccactcattactcaggatgct | g                                  c.*570

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Tumor necrosis factor receptor superfamily, member 13B protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.