tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the TNFRSF13C gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000022.10, covering TNFRSF13C transcript NM_052945.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CGTCCTTGTCTCCGTCGGGGGCCTCTGCGGAGGACGCGCCGCGAAGCCGCCGCTGTCGCC       c.60
 R  P  C  L  R  R  G  P  L  R  R  T  R  R  E  A  A  A  V  A         p.20

          .         .         .         .         .         .       g.120
 GCCTCCAGCTCACCAGACCCACCAGGACCAGCGCCAGGACCAGTGCCAGGCCCAGCAGCG       c.120
 A  S  S  S  P  D  P  P  G  P  A  P  G  P  V  P  G  P  A  A         p.40

          .         .         .         .         .         .       g.180
 CGGGGGCGCCAAAGAGCAGCCCGGGCAGGGGCAGCGCCGCCTCGCCGGCCCCCGCGCCCA       c.180
 R  G  R  Q  R  A  A  R  A  G  A  A  P  P  R  R  P  P  R  P         p.60

          .         .         .         .         .  | 02      .    g.546
 CCGACTCCTGCGGCTGCAGCGCCGTCCTGGGCGCAGGGCTGCTGGCCCCGG | CCGGTTTCG    c.240
 P  T  P  A  A  A  A  P  S  W  A  Q  G  C  W  P  R   | P  V  S      p.80

          .         .         .         .         .         .       g.606
 GCCGCGGCGTGCGCAGGAGCCCGCAGGCCACGCAGTGGCGGACCAGCAGGTCGAAGCACT       c.300
 A  A  A  C  A  G  A  R  R  P  R  S  G  G  P  A  G  R  S  T         p.100

          .         .         .         .         .         .       g.666
 CGGCCGGGACGCAGGGCGTGGGGGCTGGCGCGTCCCTGCCCCGCAGGCTCCGGGGCCCTC       c.360
 R  P  G  R  R  A  W  G  L  A  R  P  C  P  A  G  S  G  A  L         p.120

          .         .         .         .                       g.708
 GCCTCATGGTGCCGACGCCGCCGCACAAGCTGCGGGGACTGA |                      c.403
 A  S  W  C  R  R  R  R  T  S  C  G  D  X                        p.133

           | 03        .         .         .         .         .                                                      g.768
 ggctgagct | a                                                      c.*10

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Tumor necrosis factor receptor superfamily, member 13C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.