unc-119 homolog (C. elegans) (UNC119) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the UNC119 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering UNC119 transcript NM_005148.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 TCAGCTCCTCGGAGAGAGGGGGGAAGTCGTAAATGTGCTCGCAGGTGTTCTTGCTGCTGG       c.60
 S  A  P  R  R  E  G  G  S  R  K  C  A  R  R  C  S  C  C  W         p.20

          .         .         .                                     g.96
 GGATGCAGAAGCCAAAGTGGAAGTCGAAGCTTTTGA                               c.96
 G  C  R  S  Q  S  G  S  R  S  F  X                                 p.31

          .         .         .         .         .         .       g.156
 gtagctggttgcggaagtagtgcctctcgatcatgcggaagttgttgacaggcttgtctc       c.*60

          .        | 02.         .         .         .         .    g.365
 ccactgtgaactccacc | gtggctcccacctgcctcaggcggaggaaggcaggcgtgaact    c.*120

          .         .         .         .         .         .       g.425
 ggtagcggacaaagcgcccagcattggggtccaggtcccgccggttgatgggcaaccgtt       c.*180

  | 03       .         .         .         .         .         .    g.975
  | ctgagactgggggcttcttgatttcaaagaggacagtgcctgagtccatgtcccgaatct    c.*240

          .         .         .         .         .     | 04   .    g.4667
 taaacctgacaaagtcgatcttgtagatattctcctcaggggagcagaggtagt | caccgg    c.*300

          .         .         .         .         .         .       g.4727
 tgatccgctgcagccccagcacgtcctccggcccgatcggctgcttcctctgcagcggcc       c.*360

          .         .         .         .         .         .       g.4787
 ccggcctgggccctgggcctgcgtccggctccgactcggacccagattcggattccgcag       c.*420

          .         .         .         .         .         .       g.4847
 gcggctgtggtatgggggccacgctctggcccgagggccccggagcggactccgtcgccg       c.*480

          .         .         .         .         .         .       g.4907
 tcccggccccaccgccgcccttcttcaccttcatggccttgcggggccgaggctcgcctg       c.*540

          .         .         .         .      | 05  .         .                  g.4967
 ctgctgccgccgctgcctgcgccggctggagccgggggaagtggg | t                  c.*586

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Unc-119 homolog (C. elegans) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.