unc-93 homolog B1 (C. elegans) (UNC93B1) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the UNC93B1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering UNC93B1 transcript NM_030930.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTCATGTGCAGGCTCGAGCCCAGGTACACGGTGAAGATGGCCACAGCCTGCCACCAGTG       c.60
 L  H  V  Q  A  R  A  Q  V  H  G  E  D  G  H  S  L  P  P  V         p.20

          .         .         .         .         .          | 02    g.1936
 GTAGATGGTGAAGATGAAGTCCTGTCTCTCCTTGTCTTCGTACAAGATTCCCAGGAGTG | T    c.120
 V  D  G  E  D  E  V  L  S  L  L  V  F  V  Q  D  S  Q  E  C  |      p.40

          .         .         .         .         .         .       g.1996
 GCTGAGTCCAGTCTTGTTCAGGGCACTGCCCACACCCCAAAGGGCAGCTGCCACATAGAG       c.180
 A  E  S  S  L  V  Q  G  T  A  H  T  P  K  G  S  C  H  I  E         p.60

          .         .         .         .         .         .       g.2056
 GATCCAGCTGTGTTGCAGGACCCGAGGCACAGGGGCCCAGAAAAAGAGGATGAAGGTGAG       c.240
 D  P  A  V  L  Q  D  P  R  H  R  G  P  E  K  E  D  E  G  E         p.80

          .         .         .         .         .         .       g.2116
 CAGCAGGTGCACCCCTGCTCCGGCCACCAGGGGCACCGGGCGTGGCAGCCACAGGCCCAG       c.300
 Q  Q  V  H  P  C  S  G  H  Q  G  H  R  A  W  Q  P  Q  A  Q         p.100

          .                                                         g.2131
 CAGGCCCAGGAGTGA                                                    c.315
 Q  A  Q  E  X                                                      p.104

          .         .         .         .         .         .       g.2191
 ggcggctgaggcgcccaggctgtaagccacgaggaggtaagccagccgctccagccccac       c.*60

          .         | 03         .         .         .         .    g.2968
 cgagcacacgccatagcc | caaggcgataccagtgcaggcaaagagcacctcgaagccgct    c.*120

          .         .         .         .         .         .       g.3028
 gtagataaagaaaggcacgaggtggcgcaggcggtagtcacgcacgtgcttgaagggcag       c.*180

          .         .         .         .         .         .       g.3088
 ctggaagatgttgccccagcccacgctgcgcagatcgatctcctccgtgggccggtaagc       c.*240

          .         .  | 04      .         .         .         .    g.4038
 ggctccgcacaaacccagcac | cagcagcatggccaggaagccactgccatgagcacgctc    c.*300

          .         .         .         .         .         .       g.4098
 tccaccacaatgaggtttccgctccgcgggagcgtccgcagaaccgtcttgttgaagccg       c.*360

          .         .      | 05  .         .         .         .    g.4717
 ctgaggatcccgtggctgttggtgc | cgcagctctgcacattgtacagcgtgtggttcagg    c.*420

          .         .         .         .         .          | 06    g.5497
 tcatacaggtagtggttcaggaaataaatcatgggcagctgggcgcaggcgaagctcag | a    c.*480

          .         .         .         .         .         .       g.5557
 tggaagaagctgtagaagatggcttggaagaccaggagatagggcgcgtgggagccccgc       c.*540

          .         .         .         .         .         .       g.5617
 ggaggccgctgcttcatcccctgcccatcctgctccttgtagtgggagtactcatggtac       c.*600

          .   | 07     .         .         .         .         .    g.5890
 ttctgcgccatc | ctggtgatgtagttgcccatggaagcccaaagaggcacgatggccatg    c.*660

          .         .         .         .         .         .       g.5950
 cccagggccacagccgagggcacaagcgtgtagtagcgctcccagtagttggtggagaca       c.*720

          .         .         .         .         .     | 08   .    g.9351
 aagagggcgtagatgcccacagcgaggaacatcatccacttcgttccaaaaaac | ctgatg    c.*780

          .         .         .         .         .         .       g.9411
 agcacaggtgtgtagagcagggcggcgatgggagtcacgttgatgcccatcagcattttg       c.*840

          .         .         .         .         .         .       g.9471
 ctgtcgatgtcgggcagccccatgttgccatacttcacctcgcggtaggtctcgtcgtag       c.*900

          .         .         | 09         .         .         .    g.10012
 tgcaggatcagctgcatctgcaggaggc | ccaggtagacgccgtaggtgagcatgcccccg    c.*960

          .         .         .         .         .         .       g.10072
 gcgctggcagccagcacgttcttgagcacgcccaggcgcttgcggcggtagtagcggcgc       c.*1020

          .         .         .         .         . | 10       .    g.10281
 tcctcctcctcctcgttgtagttggggtacgcgcccaccagctcgtccag | cggggcctcg    c.*1080

          .         .         .         .         .         .       g.10341
 ggcccgtccgggaccccgagcaggtcctcgtcgccctgcggccccgcagcccccgccatc       c.*1140

          .         .         .         .         .         .       g.10401
 gggtagagcggcggctccgcctccatggcccgaactactgcggactcgcggcggtcgccc       c.*1200

          .         .         .         .       | 11 .         .                 g.10461
 cggagtccctgcgaccgcccggccacttcctcccggcggccgggac | t                 c.*1247

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Unc-93 homolog B1 (C. elegans) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.