WAS/WASL interacting protein family, member 1 (WIPF1) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the WIPF1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering WIPF1 transcript NM_001077269.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 TCCGGCTTTCGTTTCTTGCCAGTTTGCTGGGATAACTTTTGGTCGTTTGTACATATGGCT       c.60
 S  G  F  R  F  L  P  V  C  W  D  N  F  W  S  F  V  H  M  A         p.20

          .         .         .         .         .     | 02   .    g.797
 CTGGAGGTGGCAAATCGGAAATCGGATGGAAGTAGAATCTGCTTTCCCACTCAT | CTTCAC    c.120
 L  E  V  A  N  R  K  S  D  G  S  R  I  C  F  P  T  H   | L  H      p.40

          .         .                                               g.824
 ATGGAGAGTCTTGGAAGCCATTTCTAA                                        c.147
 M  E  S  L  G  S  H  F  X                                          p.48

          .         .         .         .         .         .       g.884
 tagatgttgatggtggaggtgggggaggtgccccagcactgggcctatcaggaggaaggg       c.*60

          .         .         .         .         .         .       g.944
 gaggcctgggtccactcctgggactgtctactccactcctggatggcaactgaggggtag       c.*120

          .         .         .         .         .         .       g.1004
 caggcagggcccgagatgtgctgccgtttctgcttactggaggaggtggtgggagggggc       c.*180

  | 03       .         .         .         .         .         .    g.4666
  | ctgatcggcctggcgggtccctcactggaggtgggggtctctcactgggcgggggaggaa    c.*240

          .         .         .         .         .         .       g.4726
 gaggacctgaacgtcctggcgaaggtaacgggggcgtggacgaactgagggacagattcc       c.*300

          .         .         .         .         .         .       g.4786
 gctgtgggagtcttggggtttcgtcattgccgctggaacttggaggcagaggaggcggcc       c.*360

          .         .         .         .         .         .       g.4846
 cgggcctgctgggaggtggcggcggaggtggggcctgtgaggaggccgaaggccgcggag       c.*420

          .         .         .         .         .         .       g.4906
 tggaaggcactggaggcttgttgttctgaggaggaggagggggaaccgcttccctgtgga       c.*480

          .         .         .         .         .         .       g.4966
 tggagggcctgttgcccactggaggaggtggtggagggggtttgtcatccaaggccctgc       c.*540

          .         .         .         .         .         .       g.5026
 tgggggtaggcggcaggggaggccggttggagaagggcgaggaggagctcaagggggact       c.*600

          .         .         .         .         .         .       g.5086
 gacgtattgagcctcctcccaaagcagtgccgcggtttccagggaaagggggaggagtgg       c.*660

          .         .         .         .         .         .       g.5146
 gcccggggctgggctgcctggggcctccgggcactggtggggacccccggttgtgcggac       c.*720

          .         .         .         .         .         .       g.5206
 ttgattgaatgggtcttggagtactaggtactggaggaggaatgctatcaggctttgagc       c.*780

          .         .         .         .         .         .       g.5266
 ccacgtcgggccttgggggcggcattcggttcctctgaggctctgggggaccacttctgt       c.*840

          .         .         .         .         .         .       g.5326
 ggcctggagaaggcacaggaaacctccctgggccacttgggggtgaaaagggtttcgcag       c.*900

          .         .         .         .         .  | 04      .    g.8143
 atgtggatcttcctcccggtggcaacaatggtggtcggcttcctccagaat | cattatccc    c.*960

          .         .         .         .         .         .       g.8203
 tgttggccgtggatctcagcttcggcattccagcctggaacaatcctcccagacctggag       c.*1020

          .         .         .         .         .         .       g.8263
 gtccgccccctccaaaacttccaccgcctccgccaccacctcctccgccaaatccgccgc       c.*1080

          .         .         .         .         | 05         .    g.14252
 ctccaccaaagccaccaccaccgcctccagcaccagctcctttaggtt | tgtccagtattg    c.*1140

          .         .         .         .         .         .       g.14312
 gtgcacttctgtcattggtgaccgtcttctttagtttcttccctttgctgatatcagaaa       c.*1200

          .         .         .         .         .         | 06    g.18455
 ggagagcatttctcccagcctgctctgtcttattcaaggtaggcttctctgtattggc | ca    c.*1260

          .         .         .         .         .         .       g.18515
 gtgcaaacgtcgggggcggcgggggtgctggagggggagggacaggcatcttgggcagtt       c.*1320

          .         .        | 07.         .         .         .    g.115737
 atgcgttcaacagtcttgctgataaat | cgcgcagcggctccggacgactccgcagccccg    c.*1380

          .         .         .         .         .         .       g.115797
 cgccgcgctgggcattttttctgggaaacttctcccggggtccgcagggctgagccgggc       c.*1440

          .         .         .    | 08    .         .         .                              g.115857
 gggcaggaaaagcgctcagcgccgggaggctgc | t                              c.*1474

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The WAS/WASL interacting protein family, member 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.