zinc finger and BTB domain containing 24 (ZBTB24) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the ZBTB24 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering ZBTB24 transcript NM_014797.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .                                               g.24
 CGATGGATTCTGATGTGGGTCTGA                                           c.24
 R  W  I  L  M  W  V  X                                             p.7

          .         .         .         .         .         | 02    g.7748
 agagaactctttgctgtgaaagatttgccacagatttcacaagtaaatggcttctcac | ct    c.*60

          .         .         .         .         .         .       g.7808
 gtgtgtgttcgcagatgtttctttagctgagacacatccatgaatttgcgatggcagtct       c.*120

          .         .   | 03     .         .         .         .    g.8560
 ttgcattccggtaatgagtggc | ctgtatgaactcggtaatggctctttagctgtctgttc    c.*180

          .         .         .         .       | 04 .         .    g.9124
 tggctgaaatattttccgcattgatcacaggtaaaagacttctgtc | ctgagtgcaggctc    c.*240

          .         .         .         .         .         .       g.9184
 atgtgctccagcagtgagtgcttggtggtcagagccttgctgcacacggtgcaggtgtac       c.*300

          .         .         .         .         .         .       g.9244
 ggccgctcgcctgtgtgcatcctggtgtggacctgtagcgagtgcttctgggcaaagcct       c.*360

          .         .         .     | 05   .         .         .    g.13448
 tttccacactcattacatttgaaaggtcgctccc | ctgtgtggctcctctggtggattgct    c.*420

          .         .         .         .         .         .       g.13508
 aaaaagtgattgtacttaaagaccttgccacagtctttacagcgggcctcagggcctcca       c.*480

          .         .         .         .         .         .       g.13568
 gggcgctttctccttccacagatcctcttggctgaaccatggtcctcttgatccccaaca       c.*540

          .         .         .         .         .         .       g.13628
 agtttgtaatctttaagtttgacggatctccaaatcctccgcttgctgtatcgactctgg       c.*600

          .         .         .         .         .         .       g.13688
 cttgcctggccatcctcggtcttgggatcatagttctcatctttttcaactggcatttcc       c.*660

          .         .         .         .         .         .       g.13748
 tcctctctacttggctcacaagtaggctccgattcttccttttcttttgctgcaatttgc       c.*720

          .         .         .         .         .         .       g.13808
 tcattcagtacaccactgtctcctttaaccacaaagttttgtctattctgaactgaattg       c.*780

          .         .         .         .         .         .       g.13868
 ttcactcttaactgtatttcttcctctgcagccagttctgatttctcctcctgcaatgta       c.*840

          .         .         .         .         .         .       g.13928
 ttgactttttttggtcttccccgtttccgctttggaggatcgtttttcttattagagata       c.*900

          .         .         .         .         .         .       g.13988
 acaaccactggggcaccagcagtgttcaaagttgttggctttggggagctatgattattt       c.*960

          .         .         .         .         .         .       g.14048
 tggaagtctgtgtaagcctttaccaggtcatagacttttaagaactgagcagtagccagg       c.*1020

          .         .         .         .         .         .       g.14108
 atttgttctgtacttttctcactggcatggagataacctgtgtagataaattccagcagg       c.*1080

          .         .         .         .         .         .       g.14168
 ataccaaaggtgtctgcaaccatgccttccagcatataaatggattggccgatttccccc       c.*1140

          .         .         .         .         .         .       g.14228
 tcttctgcaaacatcattgagaagtattcactactggcagcaagtaaggctttgtgggcc       c.*1200

          .         .         .         .         .         .       g.14288
 cggaaatgtacattctccacgattaaagtaatgtcacagaggaagcctttcttcctctga       c.*1260

          .         .         .         .         .         .       g.14348
 tcctcaaaactggccagcacagtgtcactgtgagcgtctgagtgtacaacaagctgccca       c.*1320

          .         .         .         .         .     | 06   .    g.15451
 gaaggctctggcgatgtttctgccattttcttcagaagccactaagggttaaat | ccggcg    c.*1380

          .         .         .         .         .         .       g.15511
 gcctggcgggagacccacgccggggcccgctggccctccgctccgccccgcccgcctctg       c.*1440

          .         .         .         .         .         .       g.15571
 gggcttctgcgccgcaccggtttctgctcctgcgccgccgccgcagccacagccacagcc       c.*1500

          .     | 07   .         .         .         .         .                                                 g.15631
 aacccggaagcgcg | t                                                 c.*1515

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Zinc finger and BTB domain containing 24 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.