cathepsin C (CTSC) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the CTSC gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering CTSC transcript NM_001814.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTGAGCATACTGGCTACAAGACACAACCTCCTGAGGGCTTAGGATTGGGGTCTGAGAAT       c.60
 L  E  H  T  G  Y  K  T  Q  P  P  E  G  L  G  L  G  S  E  N         p.20

          .         .         .         .                           g.102
 TGTTGGTTAGTATACGGATTCTCGCTTCTAGCATACCCATAG                         c.102
 C  W  L  V  Y  G  F  S  L  L  A  Y  P  X                           p.33

          .         .         . | 02       .         .         .    g.4427
 aagcaaatgagtagcagctgccacaggatg | cttggtttcgaacaggactgacaaaattga    c.*60

          .         .         .         .         .         .       g.4487
 taccatgaacatttctccagtcccaagatgttggcaaatgcaaaatcttttgctgtattt       c.*120

          .         .       | 03 .         .         .         .    g.13064
 cagcagtcagtggtgcaggtttgggc | cttgggatttttcgactgtggccaccacttctcc    c.*180

          .         .         .         .         .         .       g.13124
 taatcatatctcccagggtaagagtctcatattccatgtatgtagttgcagtccaagact       c.*240

          .         .         .         .         .         .       g.13184
 tctgaatggcattgatagctttcacaaagttgtgatcatacttgtagagcctattagaat       c.*300

    | 04     .         .         .         .         .         .    g.16313
 ac | ttttcctgagaattcttaaggtgtgctatgttgacatacacattctcagaggcagttc    c.*360

          .         .         .         .         .         .       g.16373
 ccaccttctttccggtgaaacaagcccagttccggcccaacacatcatgcacccacccag       c.*420

          .         .         .         .          | 05        .    g.38815
 tcattgtctcgttgcagtaagtggtcaccttgctgccctcttctttata | cttaaaaaagg    c.*480

          .         .         .         .         .         .       g.38875
 caaaccacttgtagtcattcaacacaatctcaaagccttggttgtaaatgatggtgaaat       c.*540

          .         .         .         .         .         .       g.38935
 ggccagaattgccaaggtcatcatatgctgtatccagcttctgaaggtacaccactactt       c.*600

          .      | 06  .         .         .         .         .    g.41413
 ttttttcttgtggtc | ccataaccgagcagttgacatcgcgctgggaaccgctggagccca    c.*660

          .         .         .         .         .         .       g.41473
 cctggaagacccaggtgcccagcaggtcaagataggtgcagttggcaggtgtgtcgcagc       c.*720

          .         .         .         .         .         .       g.41533
 gcacggcgccgtcgccggagagaagcagcaggagggcggcgagcagcaaggagggcccag       c.*780

          .         .         .         .         .         .       g.41593
 cacccatgctgcagggagctgagaaaagaggtgaagaattaccaggaagccgagcgctgc       c.*840

          .         .         .         .         | 07         .               g.41653
 gggctagcggtgagtccaccacgaggcgcgcgccttgaaatagctacg | t               c.*889

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Cathepsin C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.