glucose-6-phosphate dehydrogenase (G6PD) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the G6PD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering G6PD transcript NM_001042351.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.9
 CTGCCATAA                                                          c.9
 L  P  X                                                            p.2

          .         .         .         .         .         .       g.69
 atataggggatgggcttgggcttctccagctcaatctggtgcagcagtggggtgaaaata       c.*60

          .         .     | 02   .         .         .         .    g.234
 cgccaggcctcacggagctcgtcg | ctgcgcacgaagtgcatctggctcccgcagaagacg    c.*120

          .         .         .         .  | 03      .         .    g.398
 tccaggatgaggcgctcgtaggcgtcagggagcttcacgtt | cttgtatctgttgccgtag    c.*180

          .         .         .         .         .         .       g.458
 gtcaggtccagctccgactcctcggggttgaagaacatgcccggcttcttggtcatcatc       c.*240

          .         .         .         .         .         .       g.518
 ttggtgtacacggcctcgttgggctgcacgcggatcaccagctcgttgcgcttgcactgc       c.*300

          .         .         .         .         .         .       g.578
 tggtggaagatgtcgccggccacatcatggaactgcagcctcacctcggccttgcgctcg       c.*360

          .         .         .        | 04.         .         .    g.777
 ttcagggccttgccgcagcgcaggatgaagggcaccc | catcccacctctcattctccaca    c.*420

          .         .         .         .         .         .       g.837
 tagaggacgacggctgcaaaagtggcggtggtggacccgcggggcaccgtggggtcgtcc       c.*480

          .         .         .         .         .         .       g.897
 aggtaccctttggtggcctcgccctctccatcggggttccccacgtactggcccaggacc       c.*540

          .         .         .         .     | 05   .         .    g.1404
 acattgttggcctgcacctctgagatgcatttcaacaccttgac | cttctcatcacggacg    c.*600

          .         .         .         .         .         .       g.1464
 tcatctgagttggtggaggcgggcttctccatggccaccagacacagcatctgcagtagg       c.*660

          .         | 06         .         .         .         .    g.1889
 tggttctgcatcacgtcc | cggatgatcccaaattcatcgaaatagcccccgcgaccctca    c.*720

          .         .         .         .         .         .       g.1949
 gtgccaaagggctccttgaaggtgaggataacgcaggcgatgttgtcccggttccagatg       c.*780

          .         .     | 07   .         .         .         .    g.2186
 gggccgaagatcctgttggcaaat | ctcagcaccatgaggttctgcaccatctccttgccc    c.*840

          .         .         .         .         .         .       g.2246
 aggtagtggtcgatgcggtagatctggtcctcacggaacagggaggagatgtggttggac       c.*900

          .         .         .         .         .         .       g.2306
 agccggtcagagctctgcaggtccctcccgaagggcttctccacgatgatgcggttccag       c.*960

     | 08    .         .         .         .         .         .    g.3037
 cct | atctggctcatgcaggactcgtgaatgttcttggtgacggcctcgtagacggtcggg    c.*1020

          .         .         .         .         .         .       g.3097
 ggcaaggccaggtagaagaggcggttggcctgtgaccccaggtggagggcattcatgtgg       c.*1080

          .         .         .         .         .         .       g.3157
 ctgttgaggcgctggtaggaggctgcatcatcgtactggccagccacataggagttgcgg       c.*1140

          .         .         .         .  | 09      .         .    g.3768
 gcaaagaagtcctccagcttgagcttctcctctggggtggc | cttgaagaagggctcactc    c.*1200

          .         .         .         .         .         .       g.3828
 tgtttgcggatgtcagccactgtgaggcgggaacgggcatagcccacgatgaaggtgttt       c.*1260

          .         .         . | 10       .         .         .    g.3983
 tcgggcagaaggccatcccggaacagccac | cagatggtggggtagatcttcttcttggcc    c.*1320

          | 11         .         .         .         .         .    g.13900
 aggtcacc | cgatgcacccatgatgatgaatatgtgtgtatccgactgatggaaggcatcg    c.*1380

          .         .         .         .         .         .       g.13960
 ccctggaaaagctcttcccgcaggatcccgcacacctgggtccggctcagggccacctgc       c.*1440

          .       | 12 .         .         .         .         .    g.15324
 tctgccatgacgctgt | cgagcttccgcgggcctgcagagcctggcggactcagacttctc    c.*1500

          .         .         .         .         .         .       g.15384
 tccggagcgggatgcggccctaccgcggcctcacacttctcgccggcttcccgagttctc       c.*1560

   | 13      .         .         .         .         .         .                                                              g.15444
 g | g                                                              c.*1562

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Glucose-6-phosphate dehydrogenase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.